#neet

3 questions

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows5' AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3'? Answer: 4. 5' ATCGATCGATCGATCGATCG ATCGATCG 3' Key idea: The coding strand has the same sequence as the mRNA, with T in place of U. The mRNA... Transcription, genetic code, translation, protein biosynthesis 1 answer
The unique mammalian characteristics are: Answer: 3. hairs, pinna and mammary glands Key idea: Hairs, external ear (pinna) and mammary glands are unique mammalian features. A monocon... Chordates up to classes 1 answer
Which one of the following is NOT an advantage of inbreeding? Answer: 1. It decreases the productivity of inbred population, after continuous inbreeding. Key idea: Inbreeding increases homozygosity. It... Mechanism: variation, mutation, recombination, natural selection 1 answer
Which of the following statements are correct ?A. Basophils are most abundant cells of the total WBCsB. Basophils secrete histamine, serotonin and heparinC. Basophils are involved in inflammatory responseD. Basophils have kidney shaped nucleusE. Baso… Answer: 4. B and C only Key idea: Recall the properties of basophils. A is wrong: neutrophils are the most abundant WBCs, basophils are the... Body fluids: blood, blood groups, coagulation, lymph 1 answer
Select the correct statements.A. Tetrad formation is seen during Leptotene.B. During Anaphase, the centromeres split and chromatids separate.C. Terminalization takes place during Pachytene.D. Nucleolus, Golgi complex and ER are reformed during Teloph… Answer: 3. B and D only Key idea: Check the stages of cell division. A is wrong: tetrads form in pachytene, after synapsis; leptotene is the... Cell cycle, mitosis, meiosis 1 answer
In cockroach, excretion is brought about by-A. Phallic glandB. Urecose glandC. NephrocytesD. Fat bodyE. Collaterial glandsChoose the correct answer from the options given below: Answer: 4. B, C and D only Key idea: In cockroaches, excretion is done by Malpighian tubules, and also by fat body, nephrocytes and urecose... Frog: morphology and anatomy 1 answer
Match List I with List II.List I: A. Mast cells; B. Inner surface of bronchiole; C. Blood; D. Tubular parts of nephronList II: I. Ciliated epithelium; II. Areolar connective tissue; III. Cuboidal epithelium; IV. specialised connective tissueChoose th… Answer: 4. A-II, B-I, C-IV, D-III Key idea: Match the cell or location with its tissue. Mast cells: areolar connective tissue (II). Inner su... Animal tissues: epithelial, connective, muscular, neural 1 answer
Which of the following statements are correct regarding skeletal muscle?A. Muscle bundles are held together by collagenous connective tissue layer called fascicle.B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions.C. Striated… Answer: 3. B and C only Key idea: Check each statement on skeletal muscle. A is wrong: the layer of collagenous connective tissue around bun... Locomotion: movement types, muscle contraction 1 answer
Vital capacity of lung is ________. Answer: 1. IRV + ERV + TV Key idea: Vital capacity is the maximum air that can be breathed out after a maximum inspiration. VC = ERV + TV +... Breathing and respiration: mechanism, exchange and transport of gases, volumes, disorders 1 answer
Match List I with List II.List I: A. Vasectomy; B. Coitus interruptus; C. Cervical caps; D. SaheliList II: I. Oral method; II. Barrier method; III. Surgical method; IV. Natural methodChoose the correct answer from the options given below: Answer: 3. A-III, B-IV, C-II, D-I Key idea: Classify the contraceptive method. Vasectomy: surgical (III). Coitus interruptus: natural method... Birth control, contraception and MTP 1 answer
Match List I with List II.List I (Cells): A. Peptic cells; B. Goblet cells; C. Oxyntic cells; D. Hepatic cellsList II (Secretion): I. Mucus; II. Bile juice; III. Proenzyme pepsinogen; IV. HCl and intrinsic factor for absorption of vitamin B_12Choose… Answer: 4. A-III, B-I, C-IV, D-II Key idea: Match the gastric and liver cells with their secretions. Peptic (chief) cells: pepsinogen, a pro... Animal tissues: epithelial, connective, muscular, neural 1 answer
In which blood corpuscles, the HIV undergoes replication and produces progeny viruses? Answer: 2. T _II cells Key idea: HIV enters macrophages and helper T-lymphocytes. Inside the helper T cells (T_H) the virus makes DNA with r... HIV and AIDS 1 answer
Given below are two statements:Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal)Statement II: Adult human haemoglobin, consists of 4 s… Answer: 1. Statement I is false but Statement II is true. Key idea: Check the orientation of a protein and the structure of haemoglobin. Sta... Biomolecules: proteins, carbohydrates, lipids, nucleic acids 1 answer
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.Assertion A: Endometrium is necessary for implantation of blastocyst.Reason R: In the absence of fertilization, the corpus luteum degenerates that ca… Answer: 3. Both A and R are true but R is NOT the correct explanation of A. Key idea: Both statements are true, but they are unrelated. A is... Fertilisation, embryo development to blastocyst, implantation 1 answer
Select the correct group/set of Australian Marsupials exhibiting adaptive radiation. Answer: 3. Numbat, Spotted cuscus, Flying phalanger Key idea: Adaptive radiation in Australian marsupials gave forms that resemble placental... Adaptive radiation 1 answer
Match List I with List II.List I: A. Heroin; B. Marijuana; C. Cocaine; D. MorphineList II: I. Effect on cardiovascular system; II. Slow down body function; III. Painkiller; IV. Interfere with transport of dopamineChoose the correct answer from the op… Answer: 2. A-II, B-I, C-IV, D-III Key idea: Match each drug with its effect. Heroin (smack): a depressant that slows down body functions (II... Adolescence, drug, alcohol and tobacco abuse 1 answer
Match List I with List II.List I: A. Ringworm; B. Filariasis; C. Malaria; D. PneumoniaList II: I. Haemophilus influenzae; II. Trichophyton; III. Wuchereria bancrofti; IV. Plasmodium vivaxChoose the correct answer from the options given below: Answer: 2. A-II, B-III, C-IV, D-I Key idea: Match disease and causative organism. Ringworm: Trichophyton (II). Filariasis: Wuchereria bancro... Pathogens and parasites causing human diseases 1 answer
Given below are two statements:Statement I: Electrostatic precipitator is most widely used in thermal power plant.Statement II: Electrostatic precipitator in thermal power plant removes ionising radiationsIn the light of the above statements, choose… Answer: 4. Statement I is correct but Statement II is incorrect. Key idea: An electrostatic precipitator removes particulate matter, not rad... Biodiversity: concept, patterns, importance, loss 1 answer
Given below are statements: one is labelled as Assertion A and the other is labelled as Reason R.Assertion A: Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex and medulla.Reason R: Juxta medullary neph… Answer: 4. A is true but R is false. Key idea: Nephron types depend on the position of the glomerulus, and the loop of Henle follows from it... Excretion: modes, nephron, urine formation, osmoregulation 1 answer
Which of the following functions is carried out by cytoskeleton in a cell? Answer: 4. Motility Key idea: The cytoskeleton is a network of protein filaments that gives mechanical support, maintains cell shape and hel... Cytoskeleton, cilia, flagella, centrioles; nucleus 1 answer
Broad palm with single palm crease is visible in a person suffering from- Answer: 2. Down's syndrome Key idea: Down's syndrome (trisomy 21) has typical physical features. These include a short stature, a small roun... Sex-linked inheritance, Mendelian and chromosomal disorders 1 answer
Given below are two statements:Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively… Answer: 1. Statement I incorrect but Statement II is true. Key idea: DNA is negatively charged because of its phosphate groups. Statement I... Cell theory, prokaryotic and eukaryotic cells, plant vs animal cell 1 answer
Match List I with List II.List I: A. P - wave; B. Q - wave; C. QRS complex; D. T - waveList II: I. Beginning of systole; II. Repolarisation of ventricles; III. Depolarisation of atria; IV. Depolarisation of ventriclesChoose the correct answer from th… Answer: 2. A-III, B-I, C-IV, D-II Key idea: Link each ECG wave to the heart event. P wave: depolarisation of the atria (III). Q wave: beginn... Circulation: heart, cardiac cycle, ECG, double circulation, regulation, disorders 1 answer
Which of the following statements is correct? Answer: 3. Biomagnification refers to increase in concentration of the toxicant at successive trophic levels. Key idea: Look at each stateme... Biodiversity: concept, patterns, importance, loss 1 answer

← Previous

Page 17 of 86