#neet

3 questions

A microscope has an objective of focal length 2 cm, eyepiece of focal length 4 cm and the tube length of 40 cm. If the distance of distinct vision of eye is 25 cm, the magnification in the microscope is Answer: 2. 125 Key idea: for a compound microscope, the magnification is the product of the objective magnification and the eyepiece magnifi... Microscope and astronomical telescope 1 answer
An electron (mass 9×10^-31 kg and charge 1.6×10^-19C) moving with speed c/100 (c = speed of light) is injected into a magnetic field B of magnitude 9×10^-4 T perpendicular to its direction of motion. We wish to apply an uniform electric field E toget… Answer: 2. vec E is perpendicular to vec B and its magnitude is 27×10² V m ⁻¹ Key idea: for the electron to go undeflected, the electric for... Force on moving charge in magnetic and electric fields 1 answer
There are two inclined surfaces of equal length (L) and same angle of inclination 45^° with the horizontal. One of them is rough and the other is perfectly smooth. A given body takes 2 times as much time to slide down on rough surface than on the smo… Answer: 4. 0.75 Key idea: for a fixed length L starting from rest, L=1/2 a t² , so t∝ 1/sqrt a . Smooth plane: a_s=gsin45^° . Rough plane: a... Static and kinetic friction, laws of friction, rolling friction 1 answer
The kinetic energies of two similar cars A and B are 100 J and 225 J respectively. On applying breaks, car A stops after 1000 m and car B stops after 1500 m. If F_A and F_B are the forces applied by the breaks on cars A and B, respectively, then the… Answer: 2. 2/3 Key idea: by the work-energy theorem, the brake force does work equal to the kinetic energy lost: F d = K . F_A=100/1000=0.1\... Kinetic and potential energy, work-energy theorem 1 answer
The current passing through the battery in the given circuit, is: Answer: 2. 0.5 A Key idea: the middle network is a balanced Wheatstone bridge, so the 6\ Ω resistor carries no current. Points C and D are j... Kirchhoff's laws and applications 1 answer
A bob of heavy mass m is suspended by a light string of length l. The bob is given a horizontal velocity v_0 as shown in figure. If the string gets slack at some point P making an angle θ from the horizontal, the ratio of the speed v of the bob at po… Answer: 4. (sinθ/2+3sinθ)^(1/2) Key idea: the string goes slack when the tension becomes zero, and energy is conserved along the way. At P (... Motion in a vertical circle 1 answer
The output (Y) of the given logic implementation is similar to the output of an/a ________ gate. Answer: 4. NOR Key idea: write the output of each gate in Boolean form and simplify. The upper gate is a NOR gate with inputs A and B: A+B .... Logic gates (OR, AND, NOT, NAND, NOR) 1 answer
The electric field in a plane electromagnetic wave is given by E_z = 60(5x + 1.5×10^9 t) V/m. Then expression for the corresponding magnetic field is (here subscripts denote the direction of the field) : Answer: 1. B_y = 2×10⁻⁷cos(5x+1.5×10⁹ t)T Key idea: in an EM wave, B₀=E₀/c , and vec E×vec B points along the direction of propagation. The... EM waves, characteristics and transverse nature 1 answer
A ball of mass 0.5 kg is dropped from a height of 40 m. The ball hits the ground and rises to a height of 10 m. The impulse imparted to the ball during its collision with the ground is (Take g = 9.8 m/s^2) Answer: 1. 21 NS Key idea: impulse equals change in momentum, and the velocity direction reverses at the ground. v_before=√(2gh₁)=√(2×9.8×40... Newton's laws, force and inertia, momentum, impulse 1 answer
AB is a part of an electrical circuit (see figure). The potential difference "V_A - V_B", at the instant when current i = 2 A and is increasing at a rate of 1 amp / second is: Answer: 4. 10 volt Key idea: going from A to B, add the potential change across each element. The current flows from A to B and is increasin... Self and mutual inductance 1 answer
A 2 amp current is flowing through two different small circular copper coils having radii ratio 1:2. The ratio of their respective magnetic moments will be Answer: 1. 1:4 Key idea: the magnetic moment of a current loop is M=IA=Iπ r² . The current is the same (2 A), so M∝ r² : M₁/M₂=(r₁/r₂)²=(1/2... Current loop and bar magnet as magnetic dipole, field along axis and equator 1 answer
In a certain camera, a combination of four similar thin convex lenses are arranged axially in contact. Then the power of the combination and the total magnification in comparison to the power (p) and magnification (m) for each lens will be, respectiv… Answer: 3. 4p and m⁴ Key idea: powers of thin lenses in contact add, while magnifications of successive images multiply. Power: P=p+p+p+p=4p... Magnification, power of lens, combination of thin lenses 1 answer
Match List I with List II :List I:A. Non-medicated IUDB. Copper releasing IUDC. Hormone releasing IUDD. ImplantsList II:I. Multiload 375II. ProgestogensIII. Lippes loopIV. LNG-20Choose the correct answer from the options given below : Answer: 1. A-III, B-I, C-IV, D-II Non-medicated IUD - Lippes loop (A-III). Copper releasing IUD - Multiload 375 (B-I). Hormone releasing IUD... Birth control, contraception and MTP 1 answer
Which one is the correct product of DNA dependent RNA polymerase to the given template?3'TACATGGCAAATATCCATTCA5' Answer: 2. 5'AUGUACCGUUUAUAGGUAAGU3' Key idea: RNA is made complementary and antiparallel to the template, with U instead of T. Template 3'-... Transcription, genetic code, translation, protein biosynthesis 1 answer
Given below are two statements :Statement I : The cerebral hemispheres are connected by nerve tract known as corpus callosum.Statement II : The brain stem consists of the medulla oblongata, pons and cerebrum.In the light of the above statements, choo… Answer: 4. Statement I is correct but Statement II is incorrect. Statement I is correct. The corpus callosum is the nerve tract joining the... Neural control: neuron, nervous system, nerve impulse 1 answer
Given below are two statements :Statement I : Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.Statement II : According to Gause's principle, during competitio… Answer: 1. Statement I is false but Statement II is true. Statement I is false. Gause's principle says two closely related species competing... Population interactions: mutualism, competition, predation, parasitism 1 answer
Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.[Flow chart: GnRH -> LH -> (B) -> Androgens -> Formation of spermatids; GnRH -> (A) -> (C) -> Factors -> (D)] Answer: 2. FSH, Leydig cells, Sertoli cells, spermiogenesis. Key idea: in males, LH acts on Leydig cells to make androgens, and FSH acts on... Gametogenesis: spermatogenesis and oogenesis 1 answer
The following are the statements about non-chordates :A. Pharynx is perforated by gill slits.B. Notochord is absent.C. Central nervous system is dorsal.D. Heart is dorsal if present.E. Post anal tail is absent.Choose the most appropriate answer from… Answer: 4. B, D & E only Key idea: compare chordate and non-chordate features. Non-chordates have no notochord (B), the heart, if present, i... Basis of animal classification 1 answer
Match List I with List II :List I:A. Unicellular glandular epitheliumB. Compound epitheliumC. Multicellular glandular epitheliumD. Endocrine glandular epitheliumList II:I. Salivary glandsII. PancreasIII. Goblet cells of alimentary canalIV. Moist surf… Answer: 4. A-III, B-IV, C-I, D-II Unicellular glandular epithelium - goblet cells (A-III). Compound epithelium - moist surface of buccal cav... Animal tissues: epithelial, connective, muscular, neural 1 answer
Match List I with List II :List I:A. P waveB. QRS complexC. T waveD. T-P gapList II:I. Heart muscles are electrically silent.II. Depolarisation of ventricles.III. Depolarisation of atria.IV. Repolarisation of ventricles.Choose the correct answer from… Answer: 3. A-III, B-II, C-IV, D-I Key idea: read the ECG waves. P wave - depolarisation of atria (A-III). QRS complex - depolarisation of ve... Circulation: heart, cardiac cycle, ECG, double circulation, regulation, disorders 1 answer
Match List I with List II :List I:A. Exophthalmic goiterB. AcromegalyC. Cushing's syndromeD. CretinismList II:I. Excess secretion of cortisol, moon face & hyperglycemiaII. Hypo-secretion of thyroid hormone and stunted growth.III. Hyper secretion of t… Answer: 1. A-III, B-IV, C-I, D-II Exophthalmic goitre (Graves') - excess thyroid hormone, protruding eyeballs (A-III). Acromegaly - excess g... Hormonal disorders 1 answer
Match List I with List II :List I:A. Mesozoic EraB. Proterozoic EraC. Cenozoic EraD. Paleozoic EraList II:I. Lower invertebratesII. Fish & AmphibiaIII. Birds & ReptilesIV. MammalsChoose the correct answer from the options given below : Answer: 1. A-III, B-I, C-IV, D-II Mesozoic - age of reptiles; birds appear (A-III). Proterozoic - lower invertebrates (B-I). Cenozoic - age... Evidences of evolution 1 answer
Match List I with List II related to digestive system of cockroach.List I:A. The structures used for storing of food.B. Ring of 6-8 blind tubules at junction of foregut and midgut.C. Ring of 100-150 yellow coloured thin filaments at junction of midgu… Answer: 2. A-IV, B-II, C-III, D-I Crop stores food (A-IV). Gastric caeca: a ring of 6-8 blind tubules at the foregut-midgut junction (B-II).... Frog: morphology and anatomy 1 answer
Given below are two statements :Statement I : Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced.Statement II : Both bone marrow and thymus provide micro environments for the development and maturation of… Answer: 2. Both Statement I and Statement II are correct. Key idea: primary lymphoid organs are bone marrow and thymus. Statement I is corre... Immunology basics and vaccines 1 answer

← Previous

Page 8 of 86