Transcription, genetic code, translation, protein biosynthesis
Top questions
See all →- Who proposed that the genetic code for amino acids should be made up of three nucleotides? Answer: 1. George Gamow Key idea: The triplet nature of the genetic code was first theorised by the physicist George Gamow. Since 20 amino a... 1
- Which factor is important for termination of transcription? Answer: 3. ρ (rho) Key idea: In bacteria, the sigma factor starts transcription and the rho (ρ) factor terminates it. Alpha is a subunit of... 1
- Given below are two statements :Statement I : Transfer RNAs and ribosomal RNA do not interact with mRNA.Statement II : RNA interference (RNAi) takes place in all eukaryotic organisms as a method of cellular defence.In the light of the above statement… Answer: 4. Statement I is incorrect but statement II is correct Key idea: tRNA and rRNA do interact with mRNA during translation. Statement... 1
- Which of the following are the post-transcriptional events in an eukaryotic cell?A. Transport of pre-mRNA to cytoplasm prior to splicing.B. Removal of introns and joining of exons.C. Addition of methyl group at 5' end of hnRNA.D. Addition of adenine… Answer: 2. B, C, D only Key idea: Post-transcriptional processing of hnRNA includes splicing (B), 5' capping with methylguanosine (C) and ta... 1
- Which one is the correct product of DNA dependent RNA polymerase to the given template?3'TACATGGCAAATATCCATTCA5' Answer: 2. 5'AUGUACCGUUUAUAGGUAAGU3' Key idea: RNA is made complementary and antiparallel to the template, with U instead of T. Template 3'-... 1
- Match List I with List II :List I:A. RNA polymerase IIIB. Termination of transcriptionC. Splicing of ExonsD. TATA boxList II:I. snRNPsII. PromotorIII. Rho factorIV. SnRNAs, tRNAChoose the correct answer from the options given below : Answer: 1. A-IV, B-III, C-I, D-II RNA polymerase III transcribes snRNAs and tRNA (A-IV). Rho factor terminates transcription (B-III). Splici... 1