Transcription, genetic code, translation, protein biosynthesis
- Who proposed that the genetic code for amino acids should be made up of three nucleotides? Answer: 1. George Gamow Key idea: The triplet nature of the genetic code was first theorised by the physicist George Gamow. Since 20 amino a... 1
- Which factor is important for termination of transcription? Answer: 3. ρ (rho) Key idea: In bacteria, the sigma factor starts transcription and the rho (ρ) factor terminates it. Alpha is a subunit of... 1
- Given below are two statements :Statement I : Transfer RNAs and ribosomal RNA do not interact with mRNA.Statement II : RNA interference (RNAi) takes place in all eukaryotic organisms as a method of cellular defence.In the light of the above statement… Answer: 4. Statement I is incorrect but statement II is correct Key idea: tRNA and rRNA do interact with mRNA during translation. Statement... 1
- Which of the following are the post-transcriptional events in an eukaryotic cell?A. Transport of pre-mRNA to cytoplasm prior to splicing.B. Removal of introns and joining of exons.C. Addition of methyl group at 5' end of hnRNA.D. Addition of adenine… Answer: 2. B, C, D only Key idea: Post-transcriptional processing of hnRNA includes splicing (B), 5' capping with methylguanosine (C) and ta... 1
- Which one is the correct product of DNA dependent RNA polymerase to the given template?3'TACATGGCAAATATCCATTCA5' Answer: 2. 5'AUGUACCGUUUAUAGGUAAGU3' Key idea: RNA is made complementary and antiparallel to the template, with U instead of T. Template 3'-... 1
- Match List I with List II :List I:A. RNA polymerase IIIB. Termination of transcriptionC. Splicing of ExonsD. TATA boxList II:I. snRNPsII. PromotorIII. Rho factorIV. SnRNAs, tRNAChoose the correct answer from the options given below : Answer: 1. A-IV, B-III, C-I, D-II RNA polymerase III transcribes snRNAs and tRNA (A-IV). Rho factor terminates transcription (B-III). Splici... 1
- A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end: Answer: 1. Promotor, Structural gene, Terminator Key idea: a transcription unit has a promoter, the structural gene and a terminator. The pr... 1
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows5' AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3'? Answer: 4. 5' ATCGATCGATCGATCGATCG ATCGATCG 3' Key idea: The coding strand has the same sequence as the mRNA, with T in place of U. The mRNA... 1
- The process of translation of mRNA to proteins begins as soon as : Answer: 2. The small subunit of ribosome encounters mRNA Translation begins when the small ribosomal subunit binds to the mRNA. Then the ini... 1
- Statement I :The codon ‘AUG’ codes for methionine and phenylalanine.Statement II :‘AAA’ and ‘AAG’ both codons code for the amino acid lysine.In the light of the above statements, choose the correct answer from the options given below. Answer: 4. Statement I is incorrect but Statement II is true Statement I is false: AUG codes only for methionine (it is also the start codon... 1
- Which is the "Only enzyme" that has "Capability" to catalyse Initiation, Elongation and Termination in the process of transcription in prokaryotes ? Answer: 2. DNA dependent RNA polymerase In prokaryotes a single DNA-dependent RNA polymerase catalyses initiation (with sigma factor), elong... 1
- Identify the correct statement. Answer: 2. RNA polymerase binds with Rho factor to terminate the process of transcription in bacteria. Check each statement. Capping adds me... 1
- What is the role of RNA polymerase III in the process of transcription in eukaryotes ? Answer: 2. Transcribes tRNA, 5s rRNA and snRNA In eukaryotes: RNA polymerase I transcribes 28S, 18S and 5.8S rRNA; RNA polymerase II transcr... 1
- Which of the following RNAs is not required for the synthesis of protein ? Answer: 4. siRNA Protein synthesis (translation) needs mRNA (template), tRNA (carries amino acids) and rRNA (ribosome structure and catalysi... 1
- Name the enzyme that facilitates opening of DNA helix during transcription. Answer: 4. RNA polymerase During transcription, RNA polymerase itself unwinds the DNA helix locally and synthesises RNA. DNA helicase opens... 1
- The first phase of translation is : Answer: 3. Aminoacylation of tRNA Key idea: Translation begins with charging of tRNA. The first phase is aminoacylation: an amino acid is ac... 1
- Which of the following features of genetic code does allow bacteria to produce human insulin by recombinant DNA technology ? Answer: 3. Genetic code is nearly universal Key idea: The universality of the genetic code lets one organism read another's genes. Since the... 1
- Under which of the following conditions will there be no change in the reading frame of following mRNA ?5' AACAGCGGUGCUAUU 3' Answer: 4. Deletion of GGU from 7 ^th , 8 ^th and 9 ^th positions Key idea: A change that adds or removes a multiple of 3 bases keeps the re... 1
- Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as Answer: 1. Polysome Key idea: A string of ribosomes on one mRNA, each making a copy of the polypeptide, is a polysome (polyribosome). A nucl... 1
- AGGTATCGCAT is a sequence from the coding strand of a gene. What will be the corresponding sequence of the transcribed mRNA ? Answer: 1. AGGUAUCGCAU The coding strand has the same sequence as the mRNA, with U in place of T (the template strand is the one complementa... 1
- Which of the following RNAs should be most abundant in animal cell ? Answer: 4. r-RNA Among cellular RNAs, rRNA makes up about 80% of the total RNA, so it is the most abundant. tRNA is about 15%, and mRNA only... 1
- If there are 999 bases in an RNA that codes for a protein with 333 amino acids, and the base at position 901 is deleted such that the length of the RNA becomes 998 bases, how many codons will be altered ? Answer: 2. 33 Deleting one base causes a frameshift, so every codon after the deletion point is read differently. Codon 300 covers bases 898... 1
- Spliceosomes are not found in cells of : Answer: 3. Bacteria Key idea: Spliceosomes remove introns from hnRNA (pre-mRNA) in eukaryotes. Fungi, animals and plants are eukaryotes and... 1
- DNA-dependent RNA polymerase catalyzes transcription on one strand of the DNA which is called the Answer: 4. template strand In transcription, RNA polymerase reads one DNA strand, which acts as the template strand (it has 3' to 5' polarit... 1