Every question from past board papers on Transcription, genetic code, translation, protein biosynthesis, newest paper first. Open any question for its full worked answer.
Given below are two statements :
Statement I : Transfer RNAs and ribosomal RNA do not interact with mRNA.
Statement II : RNA interference (RNAi) takes place in all eukaryotic organisms as a method of cellular defence.
In the light of the above statements, choose the most appropriate answer from the options given below :
Which of the following are the post-transcriptional events in an eukaryotic cell?
A. Transport of pre-mRNA to cytoplasm prior to splicing.
B. Removal of introns and joining of exons.
C. Addition of methyl group at 5' end of hnRNA.
D. Addition of adenine residues at 3' end of hnRNA.
E. Base pairing of two complementary RNAs.
Choose the correct answer from the options given below :
Who proposed that the genetic code for amino acids should be made up of three nucleotides?
Which factor is important for termination of transcription?
A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end:
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
Match List I with List II :
List I:
A. RNA polymerase III
B. Termination of transcription
C. Splicing of Exons
D. TATA box
List II:
I. snRNPs
II. Promotor
III. Rho factor
IV. SnRNAs, tRNA
Choose the correct answer from the options given below :
What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows
5' AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3'?
The process of translation of mRNA to proteins begins as soon as :
Identify the correct statement.
What is the role of RNA polymerase III in the process of transcription in eukaryotes ?
Which of the following RNAs is not required for the synthesis of protein ?
Which is the "Only enzyme" that has "Capability" to catalyse Initiation, Elongation and Termination in the process of transcription in prokaryotes ?
Statement I :
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II :
‘AAA’ and ‘AAG’ both codons code for the amino acid lysine.
In the light of the above statements, choose the correct answer from the options given below.
The first phase of translation is :
Name the enzyme that facilitates opening of DNA helix during transcription.
Which of the following features of genetic code does allow bacteria to produce human insulin by recombinant DNA technology ?
Under which of the following conditions will there be no change in the reading frame of following mRNA ?
5' AACAGCGGUGCUAUU 3'
Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as
AGGTATCGCAT is a sequence from the coding strand of a gene. What will be the corresponding sequence of the transcribed mRNA ?
Spliceosomes are not found in cells of :
If there are 999 bases in an RNA that codes for a protein with 333 amino acids, and the base at position 901 is deleted such that the length of the RNA becomes 998 bases, how many codons will be altered ?
Which of the following RNAs should be most abundant in animal cell ?
A complex of ribosomes attached to a single strand of RNA is known as :
Which one of the following is the starter codon ?
The equivalent of a structural gene is
Which of the following rRNAs acts as structural RNA as well as ribozyme in bacteria?
DNA-dependent RNA polymerase catalyzes transcription on one strand of the DNA which is called the
