Genetics and Evolution
- Twins are born to a family that lives next door to you. The twins are a boy and a girl. Which of the following must be true? Answer: 2. They are fraternal twins. Key idea: Monozygotic twins come from one zygote and have the same sex. A boy and a girl have different... 1
- Who proposed that the genetic code for amino acids should be made up of three nucleotides? Answer: 1. George Gamow Key idea: The triplet nature of the genetic code was first theorised by the physicist George Gamow. Since 20 amino a... 1
- Which factor is important for termination of transcription? Answer: 3. ρ (rho) Key idea: In bacteria, the sigma factor starts transcription and the rho (ρ) factor terminates it. Alpha is a subunit of... 1
- Match List I with List II :List-I: A. Alfred Hershey and Martha Chase; B. Euchromatin; C. Frederick Griffith; D. HeterochromatinList-II: I. Streptococcus pneumoniae; II. Densely packed and dark-stained; III. Loosely packed and light-stained; IV. DNA… Answer: 3. A-IV, B-III, C-I, D-II Hershey and Chase: confirmed DNA as genetic material (IV) Euchromatin: loosely packed, light-stained (III)... 1
- Histones are enriched with - Answer: 1. Lysine & Arginine Key idea: Histones are basic proteins that bind the acidic, negatively charged DNA. They are rich in the positi... 1
- Genes R and Y follow independent assortment. If RRYY produce round yellow seeds and rryy produce wrinkled green seeds, what will be the phenotypic ratio of the F2 generation? Answer: 3. Phenotypic ratio - 9 : 3 : 3 : 1 Key idea: This is a standard dihybrid cross. RRYY x rryy gives F1 RrYy (all round yellow). Selfi... 1
- With the help of given pedigree, find out the probability for the birth of a child having no disease and being a carrier (has the disease mutation in one allele of the gene) in F3 generation. Answer: 1. 1/4 Key idea: The legend shows carriers only among females, so the trait is X-linked recessive. The F2 mother is a carrier: X^AX^... 1
- What is the pattern of inheritance for polygenic trait? Answer: 2. Non-mendelian inheritance pattern Key idea: Polygenic traits are controlled by many genes, each with a small additive effect, and... 1
- Given below are two statements :Statement I : Transfer RNAs and ribosomal RNA do not interact with mRNA.Statement II : RNA interference (RNAi) takes place in all eukaryotic organisms as a method of cellular defence.In the light of the above statement… Answer: 4. Statement I is incorrect but statement II is correct Key idea: tRNA and rRNA do interact with mRNA during translation. Statement... 1
- Which of the following are the post-transcriptional events in an eukaryotic cell?A. Transport of pre-mRNA to cytoplasm prior to splicing.B. Removal of introns and joining of exons.C. Addition of methyl group at 5' end of hnRNA.D. Addition of adenine… Answer: 2. B, C, D only Key idea: Post-transcriptional processing of hnRNA includes splicing (B), 5' capping with methylguanosine (C) and ta... 1
- Which chromosome in the human genome has the highest number of genes? Answer: 3. Chromosome 1 Key idea: According to the Human Genome Project, chromosome 1 has the most genes (2968), while the Y chromosome has... 1
- As per ABO blood grouping system, the blood group of father is B^+, mother is A^+ and child is O^+. Their respective genotype can beA. I^Bi / I^Ai / iiB. I^BI^B / I^AI^A / iiC. I^AI^B / iI^A / I^BiD. I^Ai / I^Bi / I^AiE. iI^B / iI^A / I^AI^BChoose th… Answer: 2. A only Key idea: a child with blood group O must be ii, getting one i allele from each parent. So both parents must carry i: fath... 1
- Which one is the correct product of DNA dependent RNA polymerase to the given template?3'TACATGGCAAATATCCATTCA5' Answer: 2. 5'AUGUACCGUUUAUAGGUAAGU3' Key idea: RNA is made complementary and antiparallel to the template, with U instead of T. Template 3'-... 1
- Match List I with List II :List I:A. RNA polymerase IIIB. Termination of transcriptionC. Splicing of ExonsD. TATA boxList II:I. snRNPsII. PromotorIII. Rho factorIV. SnRNAs, tRNAChoose the correct answer from the options given below : Answer: 1. A-IV, B-III, C-I, D-II RNA polymerase III transcribes snRNAs and tRNA (A-IV). Rho factor terminates transcription (B-III). Splici... 1
- Match List I with List II :List I:A. Down's syndromeB. α-ThalassemiaC. β-ThalassemiaD. Klinefelter's syndromeList II:I. 11^th chromosomeII. 'X' chromosomeIII. 21^st chromosomeIV. 16^th chromosomeChoose the correct answer from the options given below… Answer: 4. A-III, B-IV, C-I, D-II Down's syndrome - trisomy of chromosome 21 (A-III). α-Thalassemia - chromosome 16 (B-IV). β-Thalassemia -... 1
- Match List I with List IIList I: A. Frederick Griffith; B. Francois Jacob & Jacque Monod; C. Har Gobind Khorana; D. Meselson & StahlList II: I. Genetic code; II. Semi-conservative mode of DNA replication; III. Transformation; IV. Lac operonChoose the… Answer: 3. A-III, B-IV, C-I, D-II Key idea: match the scientist with the discovery. Griffith: transformation (III). Jacob and Monod: lac ope... 1
- Which of the following statement is correct regarding the process of replication in E.coli? Answer: 1. The DNA dependent DNA polymerase catalyses polymerization in 5' → 3' direction. Key idea: DNA polymerases add nucleotides only in... 1
- A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny? Answer: 3. Red flowered as well as pink flowered plants Key idea: Snapdragon shows incomplete dominance: RR is red, Rr is pink, rr is white.... 1
- The lactose present in the growth medium of bacteria is transported to the cell by the action of: Answer: 4. Permease Key idea: in the lac operon, permease carries lactose into the cell. The lac operon has three structural genes: z codes... 1
- Which one of the following can be explained on the basis of Mendel's Law of Dominance?A. Out of one pair of factors one is dominant and the other is recessive.B. Alleles do not show any expression and both the characters appear as such in F_2 generat… Answer: 3. A, C, D and E only Key idea: the Law of Dominance covers factors in pairs, dominant and recessive factors, and expression of only... 1
- Match List I with List IIList I: A. Two or more alternative forms of a gene; B. Cross of F_1 progeny with homozygous recessive parent; C. Cross of F_1 progeny with any of the parents; D. Number of chromosome sets in plantList II: I. Back cross; II. P… Answer: 4. A-III, B-IV, C-I, D-II Key idea: match the genetic term with its definition. Alternative forms of a gene: allele (III). Cross of... 1
- A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end: Answer: 1. Promotor, Structural gene, Terminator Key idea: a transcription unit has a promoter, the structural gene and a terminator. The pr... 1
- In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it? Answer: 3. bb Key idea: an unknown dominant phenotype is tested by a test cross with the homozygous recessive parent. Cross the black plant... 1
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows5' AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3'? Answer: 4. 5' ATCGATCGATCGATCGATCG ATCGATCG 3' Key idea: The coding strand has the same sequence as the mRNA, with T in place of U. The mRNA... 1