Which chromosome in the human genome has the highest number of genes?
Genetics and Evolution
Every question from past board papers on Genetics and Evolution, newest paper first. Open any question for its full worked answer.
NEET UG 2025 question paper (official, booklet 45)
Full paper →-
-
Given below are two statements :
Statement I : Transfer RNAs and ribosomal RNA do not interact with mRNA.
Statement II : RNA interference (RNAi) takes place in all eukaryotic organisms as a method of cellular defence.
In the light of the above statements, choose the most appropriate answer from the options given below :
-
Which of the following are the post-transcriptional events in an eukaryotic cell?
A. Transport of pre-mRNA to cytoplasm prior to splicing.
B. Removal of introns and joining of exons.
C. Addition of methyl group at 5' end of hnRNA.
D. Addition of adenine residues at 3' end of hnRNA.
E. Base pairing of two complementary RNAs.
Choose the correct answer from the options given below :
-
What is the pattern of inheritance for polygenic trait?
-
Match List I with List II :
List-I: A. Alfred Hershey and Martha Chase; B. Euchromatin; C. Frederick Griffith; D. Heterochromatin
List-II: I. Streptococcus pneumoniae; II. Densely packed and dark-stained; III. Loosely packed and light-stained; IV. DNA as genetic material confirmation
Choose the correct answer from the options given below :
-
Genes R and Y follow independent assortment. If RRYY produce round yellow seeds and rryy produce wrinkled green seeds, what will be the phenotypic ratio of the F2 generation?
-
Histones are enriched with -
-
With the help of given pedigree, find out the probability for the birth of a child having no disease and being a carrier (has the disease mutation in one allele of the gene) in F3 generation.
-
Who proposed that the genetic code for amino acids should be made up of three nucleotides?
-
Which factor is important for termination of transcription?
-
Twins are born to a family that lives next door to you. The twins are a boy and a girl. Which of the following must be true?
NEET UG 2024 question paper (official, booklet S6)
Full paper →-
In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?
-
A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?
-
The lactose present in the growth medium of bacteria is transported to the cell by the action of:
-
Which one of the following can be explained on the basis of Mendel's Law of Dominance?
A. Out of one pair of factors one is dominant and the other is recessive.
B. Alleles do not show any expression and both the characters appear as such in \(F_2\) generation.
C. Factors occur in pairs in normal diploid plants.
D. The discrete unit controlling a particular character is called factor.
E. The expression of only one of the parental characters is found in a monohybrid cross.
Choose the correct answer from the options given below:
-
Match List I with List II
List I: A. Two or more alternative forms of a gene; B. Cross of \(F_1\) progeny with homozygous recessive parent; C. Cross of \(F_1\) progeny with any of the parents; D. Number of chromosome sets in plant
List II: I. Back cross; II. Ploidy; III. Allele; IV. Test cross
Choose the correct answer from the options given below:
-
A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end:
-
Which of the following statement is correct regarding the process of replication in E.coli?
-
Match List I with List II
List I: A. Frederick Griffith; B. Francois Jacob & Jacque Monod; C. Har Gobind Khorana; D. Meselson & Stahl
List II: I. Genetic code; II. Semi-conservative mode of DNA replication; III. Transformation; IV. Lac operon
Choose the correct answer from the options given below:
-
Match List I with List II :
List I:
A. Down's syndrome
B. α-Thalassemia
C. β-Thalassemia
D. Klinefelter's syndrome
List II:
I. \(11^{th}\) chromosome
II. 'X' chromosome
III. \(21^{st}\) chromosome
IV. \(16^{th}\) chromosome
Choose the correct answer from the options given below :
-
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
-
Match List I with List II :
List I:
A. RNA polymerase III
B. Termination of transcription
C. Splicing of Exons
D. TATA box
List II:
I. snRNPs
II. Promotor
III. Rho factor
IV. SnRNAs, tRNA
Choose the correct answer from the options given below :
-
As per ABO blood grouping system, the blood group of father is \(B^+\), mother is \(A^+\) and child is \(O^+\). Their respective genotype can be
A. \(I^Bi\) / \(I^Ai\) / \(ii\)
B. \(I^BI^B\) / \(I^AI^A\) / \(ii\)
C. \(I^AI^B\) / \(iI^A\) / \(I^Bi\)
D. \(I^Ai\) / \(I^Bi\) / \(I^Ai\)
E. \(iI^B\) / \(iI^A\) / \(I^AI^B\)
Choose the most appropriate answer from the options given below :
NEET UG 2023 question paper (official, booklet G6)
Full paper →-
Expressed Sequence Tags (ESTs) refers to
-
Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by
-
What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
-
Unequivocal proof that DNA is the genetic material was first proposed by
-
The phenomenon of pleiotropism refers to
-
Which of the following statements are correct about Klinefelter's Syndrome?
A. This disorder was first described by Langdon Down (1866).
B. Such an individual has overall masculine development. However, the feminine development is also expressed.
C. The affected individual is short statured.
D. Physical, psychomotor and mental development is retarded.
E. Such individuals are sterile.
Choose the correct answer from the options given below :
-
Match List I with List II.
List I: A. Gene 'a'; B. Gene 'y'; C. Gene 'i'; D. Gene 'z'
List II: I. β-galactosidase; II. Transacetylase; III. Permease; IV. Repressor protein
Choose the correct answer from the options given below:
-
Broad palm with single palm crease is visible in a person suffering from-
-
Which one of the following symbols represents mating between relatives in human pedigree analysis?
-
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows
5' AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3'?
NEET UG 2022 question paper (official, booklet R6)
Full paper →-
DNA polymorphism forms the basis of :
-
XO type of sex determination can be found in :
-
The process of translation of mRNA to proteins begins as soon as :
-
Given below are two statements :
Statement I :
Mendel studied seven pairs of contrasting traits in pea plants and proposed the Laws of Inheritance
Statement II :
Seven characters examined by Mendel in his experiment on pea plants were seed shape and colour, flower colour, pod shape and colour, flower position and stem height
In the light of the above statements, choose the correct answer from the options given below :
-
Which of the following occurs due to the presence of autosome linked dominant trait ?
-
If a geneticist uses the blind approach for sequencing the whole genome of an organism, followed by assignment of function to different segments, the methodology adopted by him is called as :
-
Given below are two statements : one is labelled as Assertion (A) and the other is labelled as Reason (R).
Assertion (A) :
Mendel's law of Independent assortment does not hold good for the genes that are located closely on the same chromosome.
Reason (R) :
Closely located genes assort independently.
In the light of the above statements, choose the correct answer from the options given below :
-
In an E.coli strain i gene gets mutated and its product can not bind the inducer molecule. If growth medium is provided with lactose, what will be the outcome ?
-
If the length of a DNA molecule is 1.1 metres, what will be the approximate number of base pairs ?
-
The recombination frequency between the genes a & c is 5%, b & c is 15%, b & d is 9%, a & b is 20%, c & d is 24% and a & d is 29%. What will be the sequence of these genes on a linear chromosome ?
-
If a colour blind female marries a man whose mother was also colour blind, what are the chances of her progeny having colour blindness ?
-
Ten E.coli cells with \(^{15}N\) - dsDNA are incubated in medium containing \(^{14}N\) nucleotide. After 60 minutes, how many E.coli cells will have DNA totally free from \(^{15}N\) ?
NEET UG 2021 question paper (official, booklet M4)
Full paper →-
The production of gametes by the parents, formation of zygotes, the F1 and F2 plants, can be understood from a diagram called :
-
DNA strands on a gel stained with ethidium bromide when viewed under UV radiation, appear as :
-
Mutations in plant cells can be induced by :
-
Complete the flow chart on central dogma.
(a) DNA (with circular arrow) --(b)--> mRNA --(c)--> (d)
-
Identify the correct statement.
-
What is the role of RNA polymerase III in the process of transcription in eukaryotes ?
-
DNA fingerprinting involves identifying differences in some specific regions in DNA sequence, called as :
-
Which of the following RNAs is not required for the synthesis of protein ?
-
Which is the "Only enzyme" that has "Capability" to catalyse Initiation, Elongation and Termination in the process of transcription in prokaryotes ?
-
In a cross between a male and female, both heterozygous for sickle cell anaemia gene, what percentage of the progeny will be diseased ?
-
Persons with ‘AB’ blood group are called as "Universal recipients". This is due to :
-
If Adenine makes 30% of the DNA molecule, what will be the percentage of Thymine, Guanine and Cytosine in it ?
-
Which one of the following statements about Histones is wrong ?
-
Statement I :
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II :
‘AAA’ and ‘AAG’ both codons code for the amino acid lysine.
In the light of the above statements, choose the correct answer from the options given below.
NEET UG 2020 question paper (official, booklet E1)
Full paper →-
Identify the wrong statement with reference to the gene 'I' that controls ABO blood groups.
-
Select the correct match.
-
The first phase of translation is :
-
How many true breeding pea plant varieties did Mendel select as pairs, which were similar except in one character with contrasting traits ?
-
Name the enzyme that facilitates opening of DNA helix during transcription.
-
If the distance between two consecutive base pairs is 0.34 nm and the total number of base pairs of a DNA double helix in a typical mammalian cell is \(6.6\times10^9\) bp, then the length of the DNA is approximately :
-
Which of the following statements is correct ?
-
Experimental verification of the chromosomal theory of inheritance was done by :
NEET UG 2019 question paper (official, booklet P1)
Full paper →-
Purines found both in DNA and RNA are :
-
Select the incorrect statement.
-
What map unit (Centimorgan) is adopted in the construction of genetic maps ?
-
In \(\textit{Antirrhinum}\) (Snapdragon), a red flower was crossed with a white flower and in \(F_1\) generation, pink flowers were obtained. When pink flowers were selfed, the \(F_2\) generation showed white, red and pink flowers. Choose the incorrect statement from the following :
-
Which of the following features of genetic code does allow bacteria to produce human insulin by recombinant DNA technology ?
-
Expressed Sequence Tags (ESTs) refers to :
-
The frequency of recombination between gene pairs on the same chromosome as a measure of the distance between genes was explained by :
-
Match the following genes of the Lac operon with their respective products :
(a) i gene (i) \(\beta\)-galactosidase
(b) z gene (ii) Permease
(c) a gene (iii) Repressor
(d) y gene (iv) Transacetylase
Select the correct option.
-
Under which of the following conditions will there be no change in the reading frame of following mRNA ?
5' AACAGCGGUGCUAUU 3'
-
What is the genetic disorder in which an individual has an overall masculine development, gynaecomastia, and is sterile ?
NEET UG 2018 question paper (official, booklet EE)
Full paper →-
The experimental proof for semiconservative replication of DNA was first shown in a
-
Select the *correct* match :
-
Select the *correct* statement :
-
Which of the following pairs is *wrongly* matched ?
-
Select the *correct* match :
-
Which of the following characteristics represent 'Inheritance of blood groups' in humans ?
a. Dominance
b. Co-dominance
c. Multiple allele
d. Incomplete dominance
e. Polygenic inheritance
-
Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as
-
All of the following are part of an operon except
-
AGGTATCGCAT is a sequence from the coding strand of a gene. What will be the corresponding sequence of the transcribed mRNA ?
-
A woman has an X-linked condition on one of her X chromosomes. This chromosome can be inherited by
NEET UG 2017 question paper (official, booklet B)
Full paper →-
Among the following characters, which one was not considered by Mendel in his experiments on pea ?
-
The association of histone H1 with a nucleosome indicates :
-
DNA replication in bacteria occurs :
-
Spliceosomes are not found in cells of :
-
A disease caused by an autosomal primary non-disjunction is :
-
Thalassemia and sickle cell anemia are caused due to a problem in globin molecule synthesis. Select the correct statement.
-
During DNA replication, Okazaki fragments are used to elongate :
-
The genotypes of a Husband and Wife are \(I^AI^B\) and \(I^Ai\).
Among the blood types of their children, how many different genotypes and phenotypes are possible ?
-
The final proof for DNA as the genetic material came from the experiments of :
-
If there are 999 bases in an RNA that codes for a protein with 333 amino acids, and the base at position 901 is deleted such that the length of the RNA becomes 998 bases, how many codons will be altered ?
-
Which of the following RNAs should be most abundant in animal cell ?
-
Which one from those given below is the period for Mendel's hybridization experiments ?
NEET UG 2016 Phase 1 question paper (official, booklet A)
Full paper →-
Which of the following most appropriately describes haemophilia ?
-
Which of the following is required as inducer(s) for the expression of Lac operon ?
-
A complex of ribosomes attached to a single strand of RNA is known as :
-
A tall true breeding garden pea plant is crossed with a dwarf true breeding garden pea plant. When the F\(_1\) plants were selfed the resulting genotypes were in the ratio of :
-
Match the terms in Column I with their description in Column II and choose the correct option :
Column I: (a) Dominance; (b) Codominance; (c) Pleiotropy; (d) Polygenic inheritance
Column II: (i) Many genes govern a single character; (ii) In a heterozygous organism only one allele expresses itself; (iii) In a heterozygous organism both alleles express themselves fully; (iv) A single gene influences many characters
Code :
(a) (b) (c) (d)
-
Pick out the correct statements :
(a) Haemophilia is a sex-linked recessive disease.
(b) Down's syndrome is due to aneuploidy.
(c) Phenylketonuria is an autosomal recessive gene disorder.
(d) Sickle cell anaemia is an X - linked recessive gene disorder.
-
Which of the following is not required for any of the techniques of DNA fingerprinting available at present ?
-
Which one of the following is the starter codon ?
-
In a testcross involving F\(_1\) dihybrid flies, more parental-type offspring were produced than the recombinant-type offspring. This indicates :
NEET UG 2016 Phase 2 question paper (official, booklet ZZ)
Full paper →-
Taylor conducted the experiments to prove semiconservative mode of chromosome replication on
-
The mechanism that causes a gene to move from one linkage group to another is called
-
The equivalent of a structural gene is
-
A true breeding plant is
-
Which of the following rRNAs acts as structural RNA as well as ribozyme in bacteria?
-
If a colour-blind man marries a woman who is homozygous for normal colour vision, the probability of their son being colour-blind is
-
A molecule that can act as a genetic material must fulfill the traits given below, except
-
DNA-dependent RNA polymerase catalyzes transcription on one strand of the DNA which is called the
-
The central dogma of molecular genetics states that the genetic information flows from