Botany

8 chapters 620 solved questions 22 tests

Ask a question

Epiphytes that are growing on a mango branch is an example of which of the following? Answer: 1. Commensalism Key idea: Commensalism is an interaction where one species benefits and the other is neither harmed nor helped. An e... Population interactions: mutualism, competition, predation, parasitism 1 answer
Given below are two statements :Statement I : The primary source of energy in an ecosystem is solar energy.Statement II : The rate of production of organic matter during photosynthesis in an ecosystem is called net primary productivity (NPP).In the l… Answer: 3. Statement I is correct but statement II is incorrect Key idea: Statement II defines the wrong term. Statement I is correct: solar... Productivity and decomposition 1 answer
Which chromosome in the human genome has the highest number of genes? Answer: 3. Chromosome 1 Key idea: According to the Human Genome Project, chromosome 1 has the most genes (2968), while the Y chromosome has... Human genome project and DNA fingerprinting 1 answer
The complex II of mitochondrial electron transport chain is also known as Answer: 2. Succinate dehydrogenase Key idea: Complex II of the electron transport chain is succinate dehydrogenase. It is the Krebs cycle en... TCA cycle and electron transport system, ATP yield 1 answer
Given below are two statements : One is labelled as Assertion (A) and the other is labelled as Reason (R).Assertion (A) : Both wind and water pollinated flowers are not very colourful and do not produce nectar.Reason (R) : The flowers produce enormou… Answer: 2. Both A and R are true but R is NOT the correct explanation of A Key idea: Both A and R are true, but R does not explain A. Wind a... Pollination: types, agencies, examples 1 answer
Given below are two statements :Statement I : In a floral formula ⊕ stands for zygomorphic nature of the flower, and G (underlined) stands for inferior ovary.Statement II : In a floral formula ⊕ stands for actinomorphic nature of the flower and G (un… Answer: 4. Statement I is incorrect but statement II is correct Key idea: In floral formulae the symbol oplus means actinomorphic (radial sy... Flower, fruit and seed 1 answer
Regarding catalytic cycle of an enzyme action, select the correct sequential steps :A. Substrate enzyme complex formation.B. Free enzyme ready to bind with another substrate.C. Release of products.D. Chemical bonds of the substrate broken.E. Substrat… Answer: 2. E, A, D, C, B Key idea: catalytic cycle of an enzyme. Substrate binds to the active site (E) → enzyme-substrate complex forms (A)... Enzymes: types, properties, action, classification 1 answer
Given below are two statements :Statement I : Mitochondria and chloroplasts are both double membrane bound organelles.Statement II : Inner membrane of mitochondria is relatively less permeable, as compared to chloroplast.In the light of the above sta… Answer: 4. Statement I is correct but Statement II is incorrect. Key idea: both organelles are bounded by two membranes, and in both the inn... Mitochondria, ribosomes, plastids, microbodies 1 answer
Given below are two statements :Statement I : Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.Statement II : According to Gause's principle, during competitio… Answer: 1. Statement I is false but Statement II is true. Statement I is false. Gause's principle says two closely related species competing... Population interactions: mutualism, competition, predation, parasitism 1 answer
As per ABO blood grouping system, the blood group of father is B^+, mother is A^+ and child is O^+. Their respective genotype can beA. I^Bi / I^Ai / iiB. I^BI^B / I^AI^A / iiC. I^AI^B / iI^A / I^BiD. I^Ai / I^Bi / I^AiE. iI^B / iI^A / I^AI^BChoose th… Answer: 2. A only Key idea: a child with blood group O must be ii, getting one i allele from each parent. So both parents must carry i: fath... Deviations: incomplete dominance, co-dominance, multiple alleles, blood groups, pleiotropy, polygenic inheritance 1 answer
Which one is the correct product of DNA dependent RNA polymerase to the given template?3'TACATGGCAAATATCCATTCA5' Answer: 2. 5'AUGUACCGUUUAUAGGUAAGU3' Key idea: RNA is made complementary and antiparallel to the template, with U instead of T. Template 3'-... Transcription, genetic code, translation, protein biosynthesis 1 answer
Match List I with List II :List I:A. RNA polymerase IIIB. Termination of transcriptionC. Splicing of ExonsD. TATA boxList II:I. snRNPsII. PromotorIII. Rho factorIV. SnRNAs, tRNAChoose the correct answer from the options given below : Answer: 1. A-IV, B-III, C-I, D-II RNA polymerase III transcribes snRNAs and tRNA (A-IV). Rho factor terminates transcription (B-III). Splici... Transcription, genetic code, translation, protein biosynthesis 1 answer
Following are the stages of cell division :A. Gap 2 phaseB. CytokinesisC. Synthesis phaseD. KaryokinesisE. Gap 1 phaseChoose the correct sequence of stages from the options given below : Answer: 1. E-C-A-D-B Key idea: interphase comes first (G1, S, G2), then M phase (karyokinesis, then cytokinesis). G1 (E) → S (C) → G2 (A) →... Cell cycle, mitosis, meiosis 1 answer
Match List I with List II :List I (Sub Phases of Prophase I):A. DiakinesisB. PachyteneC. ZygoteneD. LeptoteneList II (Specific characters):I. Synaptonemal complex formationII. Completion of terminalisation of chiasmataIII. Chromosomes look like thin… Answer: 4. A-II, B-IV, C-I, D-III Key idea: order of prophase I: leptotene, zygotene, pachytene, diplotene, diakinesis. Diakinesis - termina... Cell cycle, mitosis, meiosis 1 answer
Match List I with List II :List I:A. AxonemeB. Cartwheel patternC. CristaD. SatelliteList II:I. CentrioleII. Cilia and flagellaIII. ChromosomeIV. MitochondriaChoose the correct answer from the options given below : Answer: 1. A-II, B-I, C-IV, D-III Axoneme - the 9+2 microtubule core of cilia and flagella (A-II). Cartwheel pattern - the 9 triplet arrange... Cytoskeleton, cilia, flagella, centrioles; nucleus 1 answer
Match List I with List II :List I:A. Down's syndromeB. α-ThalassemiaC. β-ThalassemiaD. Klinefelter's syndromeList II:I. 11^th chromosomeII. 'X' chromosomeIII. 21^st chromosomeIV. 16^th chromosomeChoose the correct answer from the options given below… Answer: 4. A-III, B-IV, C-I, D-II Down's syndrome - trisomy of chromosome 21 (A-III). α-Thalassemia - chromosome 16 (B-IV). β-Thalassemia -... Sex-linked inheritance, Mendelian and chromosomal disorders 1 answer
Match List I with List IIList I: A. GLUT-4; B. Insulin; C. Trypsin; D. CollagenList II: I. Hormone; II. Enzyme; III. Intercellular ground substance; IV. Enables glucose transport into cellsChoose the correct answer from the options given below: Answer: 2. A-IV, B-I, C-II, D-III Key idea: match the protein with its role. GLUT-4: enables glucose transport into cells (IV). Insulin: hor... Biomolecules: proteins, carbohydrates, lipids, nucleic acids 1 answer
Match List I with List II :List I:A. LipaseB. NucleaseC. ProteaseD. AmylaseList II:I. Peptide bondII. Ester bondIII. Glycosidic bondIV. Phosphodiester bondChoose the correct answer from the options given below : Answer: 4. A-II, B-IV, C-I, D-III Key idea: each enzyme breaks a particular bond. Lipase - ester bond in fats (II). Nuclease - phosphodieste... Enzymes: types, properties, action, classification 1 answer
The DNA present in chloroplast is: Answer: 3. Circular, double stranded Key idea: chloroplast DNA is like bacterial DNA. It is circular and double stranded, and lies in the st... Mitochondria, ribosomes, plastids, microbodies 1 answer
Read the following statements and choose the set of correct statements:In the members of Phaeophyceae,A. Asexual reproduction occurs usually by biflagellate zoospores.B. Sexual reproduction is by oogamous method only.C. Stored food is in the form of… Answer: 4. A, C, D and E only Key idea: check each statement about brown algae. A true: asexual reproduction by biflagellate zoospores. B fa... Plant kingdom: algae, bryophytes, pteridophytes, gymnosperms 1 answer
Match List I with List IIList I: A. Robert May; B. Alexander von Humboldt; C. Paul Ehrlich; D. David TilmanList II: I. Species-Area relationship; II. Long term ecosystem experiment using out door plots; III. Global species diversity at about 7 millio… Answer: 3. A-III, B-I, C-IV, D-II Key idea: link each scientist with the idea they are known for. Robert May: global species diversity about... Biodiversity: concept, patterns, importance, loss 1 answer
In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is100x (kcal m^-2) yr^-1, what would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem? Answer: 4. 10x (kcal m⁻²) yr⁻¹ Key idea: the energy a trophic level can pass on is its net productivity; about 10 percent of it is stored by... Energy flow and ecological pyramids 1 answer
Match List I with List IIList I: A. Frederick Griffith; B. Francois Jacob & Jacque Monod; C. Har Gobind Khorana; D. Meselson & StahlList II: I. Genetic code; II. Semi-conservative mode of DNA replication; III. Transformation; IV. Lac operonChoose the… Answer: 3. A-III, B-IV, C-I, D-II Key idea: match the scientist with the discovery. Griffith: transformation (III). Jacob and Monod: lac ope... DNA as genetic material, DNA and RNA structure, DNA packaging 1 answer
Which of the following statement is correct regarding the process of replication in E.coli? Answer: 1. The DNA dependent DNA polymerase catalyses polymerization in 5' → 3' direction. Key idea: DNA polymerases add nucleotides only in... DNA replication and central dogma 1 answer

← Previous

Page 3 of 26