The complex II of mitochondrial electron transport chain is also known as
Botany
Every question from past board papers on Botany, newest paper first. Open any question for its full worked answer.
NEET UG 2025 question paper (official, booklet 45)
Full paper →-
-
Which one of the following statements refers to Reductionist Biology?
-
Epiphytes that are growing on a mango branch is an example of which of the following?
-
From the statements given below choose the correct option :
A. The eukaryotic ribosomes are 80S and prokaryotic ribosomes are 70S.
B. Each ribosome has two sub-units.
C. The two sub-units of 80S ribosome are 60S and 40S while that of 70S are 50S and 30S.
D. The two sub-units of 80S ribosome are 60S and 20S and that of 70S are 50S and 20S.
E. The two sub-units of 80S are 60S and 30S and that of 70S are 50S and 30S.
-
Which one of the following is an example of ex-situ conservation?
-
Given below are two statements :
Statement I : The primary source of energy in an ecosystem is solar energy.
Statement II : The rate of production of organic matter during photosynthesis in an ecosystem is called net primary productivity (NPP).
In the light of the above statements, choose the most appropriate answer from the options given below :
-
Given below are two statements : One is labelled as Assertion (A) and the other is labelled as Reason (R).
Assertion (A) : Both wind and water pollinated flowers are not very colourful and do not produce nectar.
Reason (R) : The flowers produce enormous amount of pollen grains in wind and water pollinated flowers.
In the light of the above statements, choose the correct answer from the options given below :
-
Which of the following is an example of non-distilled alcoholic beverage produced by yeast?
-
Given below are two statements :
Statement I : In a floral formula ⊕ stands for zygomorphic nature of the flower, and G (underlined) stands for inferior ovary.
Statement II : In a floral formula ⊕ stands for actinomorphic nature of the flower and G (underlined) stands for superior ovary.
In the light of the above statements, choose the correct answer from the options given below :
-
Streptokinase produced by bacterium Streptococcus is used for
-
Which chromosome in the human genome has the highest number of genes?
-
Which one of the following phytohormones promotes nutrient mobilization which helps in the delay of leaf senescence in plants?
-
Given below are the stages in the life cycle of pteridophytes. Arrange the following stages in the correct sequence.
A. Prothallus stage
B. Meiosis in spore mother cells
C. Fertilisation
D. Formation of archegonia and antheridia in gametophyte.
E. Transfer of antherozoids to the archegonia in presence of water.
Choose the correct answer from the options given below :
-
Which of following organisms cannot fix nitrogen?
A. Azotobacter
B. Oscillatoria
C. Anabaena
D. Volvox
E. Nostoc
Choose the correct answer from the options given below:
-
Given below are two statements :
Statement I : Transfer RNAs and ribosomal RNA do not interact with mRNA.
Statement II : RNA interference (RNAi) takes place in all eukaryotic organisms as a method of cellular defence.
In the light of the above statements, choose the most appropriate answer from the options given below :
-
Name the class of enzyme that usually catalyze the following reaction :
S – G + S# → S + S# – G
Where, G → a group other than hydrogen
S → a substrate
S# → another substrate
-
Find the statement that is NOT correct with regard to the structure of monocot stem.
-
The correct sequence of events in the life cycle of bryophytes is
A. Fusion of antherozoid with egg.
B. Attachment of gametophyte to substratum.
C. Reduction division to produce haploid spores.
D. Formation of sporophyte.
E. Release of antherozoids into water.
-
Match List - I with List - II.
List - I: A. Centromere; B. Cilium; C. Cristae; D. Cell membrane
List - II: I. Mitochondrion; II. Cell division; III. Cell movement; IV. Phospholipid Bilayer
Choose the correct answer from the options given below :
-
Match List I with List II :
List I: A. Chlorophyll a; B. Chlorophyll b; C. Xanthophylls; D. Carotenoids
List II: I. Yellow-green; II. Yellow; III. Blue-green; IV. Yellow to Yellow-orange
Choose the option with all correct matches.
-
In the seeds of cereals, the outer covering of endosperm separates the embryo by a protein-rich layer called :
-
Given below are two statements : One is labelled as Assertion (A) and the other is labelled as Reason (R).
Assertion (A) : A typical unfertilised, angiosperm embryo sac at maturity is 8 nucleate and 7-celled.
Reason (R) : The egg apparatus has 2 polar nuclei.
In the light of the above statements, choose the correct answer from the options given below :
-
A specialised membranous structure in a prokaryotic cell which helps in cell wall formation, DNA replication and respiration is :
-
Which of the following are the post-transcriptional events in an eukaryotic cell?
A. Transport of pre-mRNA to cytoplasm prior to splicing.
B. Removal of introns and joining of exons.
C. Addition of methyl group at 5' end of hnRNA.
D. Addition of adenine residues at 3' end of hnRNA.
E. Base pairing of two complementary RNAs.
Choose the correct answer from the options given below :
-
What is the pattern of inheritance for polygenic trait?
-
Which one of the following enzymes contains 'Haem' as the prosthetic group?
-
Each of the following characteristics represent a Kingdom proposed by Whittaker. Arrange the following in increasing order of complexity of body organization.
A. Multicellular heterotrophs with cell wall made of chitin.
B. Heterotrophs with tissue/organ/organ system level of body organization.
C. Prokaryotes with cell wall made of polysaccharides and amino acids.
D. Eukaryotic autotrophs with tissue/organ level of body organization.
E. Eukaryotes with cellular body organization.
Choose the correct answer from the options given below :
-
Who is known as the father of Ecology in India?
-
Match List I with List II :
List-I: A. Alfred Hershey and Martha Chase; B. Euchromatin; C. Frederick Griffith; D. Heterochromatin
List-II: I. Streptococcus pneumoniae; II. Densely packed and dark-stained; III. Loosely packed and light-stained; IV. DNA as genetic material confirmation
Choose the correct answer from the options given below :
-
Match List I with List II.
List I: A. Adenosine B. Adenylic acid C. Adenine D. Alanine
List II: I. Nitrogen base II. Nucleotide III. Nucleoside IV. Amino acid
Choose the option with all correct matches.
-
Given below are two statements : one is labelled as Assertion (A) and the other is labelled as Reason (R).
Assertion (A) : The primary function of the Golgi apparatus is to package the materials made by the endoplasmic reticulum and deliver it to intracellular targets and outside the cell.
Reason (R) : Vesicles containing materials made by the endoplasmic reticulum fuse with the cis face of the Golgi apparatus, and they are modified and released from the trans face of the Golgi apparatus.
In the light of the above statements, choose the correct answer from the options given below :
-
Match List I with List II :
List I: A. Scutellum B. Non-albuminous seed C. Epiblast D. Perisperm
List II: I. Persistent nucellus II. Cotyledon of Monocot seed III. Groundnut IV. Rudimentary cotyledon
Choose the option with all correct matches.
-
Genes R and Y follow independent assortment. If RRYY produce round yellow seeds and rryy produce wrinkled green seeds, what will be the phenotypic ratio of the F2 generation?
-
Histones are enriched with -
-
The protein portion of an enzyme is called :
-
Which of the following is the unit of productivity of an Ecosystem?
-
With the help of given pedigree, find out the probability for the birth of a child having no disease and being a carrier (has the disease mutation in one allele of the gene) in F3 generation.
-
Given below are two statements : One is labelled as Assertion (A) and the other is labelled as Reason (R).
Assertion (A) : Cells of the tapetum possess dense cytoplasm and generally have more than one nucleus.
Reason (R) : Presence of more than one nucleus in the tapetum increases the efficiency of nourishing the developing microspore mother cells.
In light of the above statements, choose the most appropriate answer from the options given below :
-
How many meiotic and mitotic divisions need to occur for the development of a mature female gametophyte from the megaspore mother cell in an angiosperm plant?
-
Which of the following is an example of a zygomorphic flower?
-
Given below are two statements :
Statement I : Fig fruit is a non-vegetarian fruit as it has enclosed fig wasps in it.
Statement II : Fig wasp and fig tree exhibit mutual relationship as fig wasp completes its life cycle in fig fruit and fig fruit gets pollinated by fig wasp.
In the light of the above statements, choose the most appropriate answer from the options given below :
-
What is the main function of the spindle fibers during mitosis ?
-
Which one of the following is the characteristic feature of gymnosperms?
-
Match List I with List II.
List I: A. Pteridophyte B. Bryophyte C. Angiosperm D. Gymnosperm
List II: I. Salvia II. Ginkgo III. Polytrichum IV. Salvinia
Choose the option with all correct matches.
-
Who proposed that the genetic code for amino acids should be made up of three nucleotides?
-
Match List I with List II :
List I: A. The Evil Quartet B. Ex situ conservation C. Lantana camara D. Dodo
List II: I. Cryopreservation II. Alien species invasion III. Causes of biodiversity losses IV. Extinction
Choose the correct matches.
-
In bryophytes, the gemmae help in which one of the following?
-
Given below are two statements :
Statement I : In ecosystem, there is unidirectional flow of energy of sun from producers to consumers.
Statement II : Ecosystems are exempted from 2nd law of thermodynamics.
In the light of the above statements, choose the most appropriate answer from the options given below :
-
Which of the following statements about RuBisCO is true?
-
Read the following statements on plant growth and development.
A. Parthenocarpy can be induced by auxins.
B. Plant growth regulators can be involved in promotion as well as inhibition of growth.
C. Dedifferentiation is a pre-requisite for re-differentiation.
D. Abscisic acid is a plant growth promoter.
E. Apical dominance promotes the growth of lateral buds.
Choose the option with all correct statements.
-
Which factor is important for termination of transcription?
-
Twins are born to a family that lives next door to you. The twins are a boy and a girl. Which of the following must be true?
-
Which of the following microbes is NOT involved in the preparation of household products?
A. Aspergillus niger
B. Lactobacillus
C. Trichoderma polysporum
D. Saccharomyces cerevisiae
E. Propionibacterium sharmanii
Choose the correct answer from the options given below:
-
Which one of the following equations represents the Verhulst-Pearl Logistic Growth of population?
NEET UG 2024 question paper (official, booklet S6)
Full paper →-
The cofactor of the enzyme carboxypeptidase is:
-
Given below are two statements:
Statement I : Parenchyma is living but collenchyma is dead tissue.
Statement II : Gymnosperms lack xylem vessels but presence of xylem vessels is the characteristic of angiosperms.
In the light of the above statements, choose the correct answer from the options given below:
-
Spindle fibers attach to kinetochores of chromosomes during
-
In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?
-
The equation of Verhulst-Pearl logistic growth is
\(\frac{dN}{dt} = rN\left[\frac{K-N}{K}\right]\).
From this equation, \(K\) indicates:
-
How many molecules of ATP and NADPH are required for every molecule of \(CO_2\) fixed in the Calvin cycle?
-
Match List I with List II
List I: A. Clostridium butylicum; B. Saccharomyces cerevisiae; C. Trichoderma polysporum; D. Streptococcus sp.
List II: I. Ethanol; II. Streptokinase; III. Butyric acid; IV. Cyclosporin-A
Choose the correct answer from the options given below:
-
These are regarded as major causes of biodiversity loss:
A. Over exploitation
B. Co-extinction
C. Mutation
D. Habitat loss and fragmentation
E. Migration
Choose the correct option:
-
Given below are two statements:
Statement I : Chromosomes become gradually visible under light microscope during leptotene stage.
Statement II : The begining of diplotene stage is recognized by dissolution of synaptonemal complex.
In the light of the above statements, choose the correct answer from the options given below:
-
Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin
-
A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?
-
Which of the following are required for the dark reaction of photosynthesis?
A. Light
B. Chlorophyll
C. \(CO_2\)
D. ATP
E. NADPH
Choose the correct answer from the options given below:
-
The lactose present in the growth medium of bacteria is transported to the cell by the action of:
-
Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b)
-
Match List I with List II
List I: A. Rhizopus; B. Ustilago; C. Puccinia; D. Agaricus
List II: I. Mushroom; II. Smut fungus; III. Bread mould; IV. Rust fungus
Choose the correct answer from the options given below:
-
The type of conservation in which the threatened species are taken out from their natural habitat and placed in special setting where they can be protected and given special care is called;
-
Match List I with List II
List I: A. Nucleolus; B. Centriole; C. Leucoplasts; D. Golgi apparatus
List II: I. Site of formation of glycolipid; II. Organization like the cartwheel; III. Site for active ribosomal RNA synthesis; IV. For storing nutrients
Choose the correct answer from the options given below:
-
The capacity to generate a whole plant from any cell of the plant is called:
-
Formation of interfascicular cambium from fully developed parenchyma cells is an example for
-
Which one of the following can be explained on the basis of Mendel's Law of Dominance?
A. Out of one pair of factors one is dominant and the other is recessive.
B. Alleles do not show any expression and both the characters appear as such in \(F_2\) generation.
C. Factors occur in pairs in normal diploid plants.
D. The discrete unit controlling a particular character is called factor.
E. The expression of only one of the parental characters is found in a monohybrid cross.
Choose the correct answer from the options given below:
-
Identify the part of the seed from the given figure which is destined to form root when the seed germinates.
-
Match List I with List II
List I: A. Two or more alternative forms of a gene; B. Cross of \(F_1\) progeny with homozygous recessive parent; C. Cross of \(F_1\) progeny with any of the parents; D. Number of chromosome sets in plant
List II: I. Back cross; II. Ploidy; III. Allele; IV. Test cross
Choose the correct answer from the options given below:
-
Identify the set of correct statements:
A. The flowers of Vallisneria are colourful and produce nectar.
B. The flowers of waterlily are not pollinated by water.
C. In most of water-pollinated species, the pollen grains are protected from wetting.
D. Pollen grains of some hydrophytes are long and ribbon like.
E. In some hydrophytes, the pollen grains are carried passively inside water.
Choose the correct answer from the options given below:
-
Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:
-
List of endangered species was released by-
-
Lecithin, a small molecular weight organic compound found in living tissues, is an example of:
-
Which of the following is an example of actinomorphic flower?
-
Tropical regions show greatest level of species richness because
A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification.
B. Tropical environments are more seasonal.
C. More solar energy is available in tropics.
D. Constant environments promote niche specialization.
E. Tropical environments are constant and predictable.
Choose the correct answer from the options given below:
-
Bulliform cells are responsible for
-
A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end:
-
Which one of the following is not a criterion for classification of fungi?
-
In the given figure, which component has thin outer walls and highly thickened inner walls?
-
Match List I with List II
List I (Types of Stamens): A. Monoadelphous; B. Diadelphous; C. Polyadelphous; D. Epiphyllous
List II (Example): I. Citrus; II. Pea; III. Lily; IV. China-rose
Choose the correct answer from the options given below:
-
The DNA present in chloroplast is:
-
Read the following statements and choose the set of correct statements:
In the members of Phaeophyceae,
A. Asexual reproduction occurs usually by biflagellate zoospores.
B. Sexual reproduction is by oogamous method only.
C. Stored food is in the form of carbohydrates which is either mannitol or laminarin.
D. The major pigments found are chlorophyll a, c and carotenoids and xanthophyll.
E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin.
Choose the correct answer from the options given below:
-
Match List I with List II
List I: A. Citric acid cycle; B. Glycolysis; C. Electron transport system; D. Proton gradient
List II: I. Cytoplasm; II. Mitochondrial matrix; III. Intermembrane space of mitochondria; IV. Inner mitochondrial membrane
Choose the correct answer from the options given below:
-
Given below are two statements:
Statement I : In \(C_3\) plants, some \(O_2\) binds to RuBisCO, hence \(CO_2\) fixation is decreased.
Statement II : In \(C_4\) plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration.
In the light of the above statements, choose the correct answer from the options given below:
-
Which of the following statement is correct regarding the process of replication in E.coli?
-
Match List I with List II
List I: A. Robert May; B. Alexander von Humboldt; C. Paul Ehrlich; D. David Tilman
List II: I. Species-Area relationship; II. Long term ecosystem experiment using out door plots; III. Global species diversity at about 7 million; IV. Rivet popper hypothesis
Choose the correct answer from the options given below:
-
Match List I with List II
List I: A. Frederick Griffith; B. Francois Jacob & Jacque Monod; C. Har Gobind Khorana; D. Meselson & Stahl
List II: I. Genetic code; II. Semi-conservative mode of DNA replication; III. Transformation; IV. Lac operon
Choose the correct answer from the options given below:
-
In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is
\(100x\,(kcal\,m^{-2})\,yr^{-1}\), what would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?
-
Match List I with List II
List I: A. Rose; B. Pea; C. Cotton; D. Mango
List II: I. Twisted aestivation; II. Perigynous flower; III. Drupe; IV. Marginal placentation
Choose the correct answer from the options given below:
-
Identify the correct description about the given figure:
-
Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.
-
Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus, increasing the yield?
-
Match List I with List II
List I: A. GLUT-4; B. Insulin; C. Trypsin; D. Collagen
List II: I. Hormone; II. Enzyme; III. Intercellular ground substance; IV. Enables glucose transport into cells
Choose the correct answer from the options given below:
-
Which of the following are fused in somatic hybridization involving two varieties of plants?
-
Match List I with List II :
List I:
A. Lipase
B. Nuclease
C. Protease
D. Amylase
List II:
I. Peptide bond
II. Ester bond
III. Glycosidic bond
IV. Phosphodiester bond
Choose the correct answer from the options given below :
-
Following are the stages of cell division :
A. Gap 2 phase
B. Cytokinesis
C. Synthesis phase
D. Karyokinesis
E. Gap 1 phase
Choose the correct sequence of stages from the options given below :
-
Match List I with List II :
List I:
A. Axoneme
B. Cartwheel pattern
C. Crista
D. Satellite
List II:
I. Centriole
II. Cilia and flagella
III. Chromosome
IV. Mitochondria
Choose the correct answer from the options given below :
-
Match List I with List II :
List I (Sub Phases of Prophase I):
A. Diakinesis
B. Pachytene
C. Zygotene
D. Leptotene
List II (Specific characters):
I. Synaptonemal complex formation
II. Completion of terminalisation of chiasmata
III. Chromosomes look like thin threads
IV. Appearance of recombination nodules
Choose the correct answer from the options given below :
-
Match List I with List II :
List I:
A. Down's syndrome
B. α-Thalassemia
C. β-Thalassemia
D. Klinefelter's syndrome
List II:
I. \(11^{th}\) chromosome
II. 'X' chromosome
III. \(21^{st}\) chromosome
IV. \(16^{th}\) chromosome
Choose the correct answer from the options given below :
-
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
-
Given below are two statements :
Statement I : Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.
Statement II : According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting.
In the light of the above statements, choose the correct answer from the options given below :
-
Match List I with List II :
List I:
A. RNA polymerase III
B. Termination of transcription
C. Splicing of Exons
D. TATA box
List II:
I. snRNPs
II. Promotor
III. Rho factor
IV. SnRNAs, tRNA
Choose the correct answer from the options given below :
-
Given below are two statements :
Statement I : Mitochondria and chloroplasts are both double membrane bound organelles.
Statement II : Inner membrane of mitochondria is relatively less permeable, as compared to chloroplast.
In the light of the above statements, choose the most appropriate answer from the options given below :
-
Regarding catalytic cycle of an enzyme action, select the correct sequential steps :
A. Substrate enzyme complex formation.
B. Free enzyme ready to bind with another substrate.
C. Release of products.
D. Chemical bonds of the substrate broken.
E. Substrate binding to active site.
Choose the correct answer from the options given below :
-
As per ABO blood grouping system, the blood group of father is \(B^+\), mother is \(A^+\) and child is \(O^+\). Their respective genotype can be
A. \(I^Bi\) / \(I^Ai\) / \(ii\)
B. \(I^BI^B\) / \(I^AI^A\) / \(ii\)
C. \(I^AI^B\) / \(iI^A\) / \(I^Bi\)
D. \(I^Ai\) / \(I^Bi\) / \(I^Ai\)
E. \(iI^B\) / \(iI^A\) / \(I^AI^B\)
Choose the most appropriate answer from the options given below :
NEET UG 2023 question paper (official, booklet G6)
Full paper →-
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : The first stage of gametophyte in the life cycle of moss is protonema stage.
Reason R : Protonema develops directly from spores produced in capsule.
In the light of the above statements, choose the most appropriate answer from the options given below :
-
Cellulose does not form blue colour with Iodine because
-
Which micronutrient is required for splitting of water molecule during photosynthesis?
-
Expressed Sequence Tags (ESTs) refers to
-
The thickness of ozone in a column of air in the atmosphere is measured in terms of :
-
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : ATP is used at two steps in glycolysis.
Reason R : First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1-6-diphosphate.
In the light of the above statements, choose the correct answer from the options given below :
-
Among 'The Evil Quartet', which one is considered the most important cause driving extinction of species?
-
Which of the following stages of meiosis involves division of centromere?
-
Which hormone promotes internode/petiole elongation in deep water rice?
-
Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by
-
How many ATP and NADPH\(_2\) are required for the synthesis of one molecule of Glucose during Calvin cycle?
-
What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
-
Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.
-
The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?
-
In the equation
\(GPP - R = NPP\)
GPP is Gross Primary Productivity
NPP is Net Primary Productivity
R here is ______.
-
The reaction centre in PS II has an absorption maxima at
-
Unequivocal proof that DNA is the genetic material was first proposed by
-
Spraying of which of the following phytohormone on juvenile conifers helps in hastening the maturity period, that leads to early seed production?
-
What is the function of tassels in the corn cob?
-
In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are :
-
Large, colourful, fragrant flowers with nectar are seen in :
-
In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as :
-
Given below are two statements :
Statement I : The forces generated by transpiration can lift a xylem-sized column of water over 130 meters height.
Statement II : Transpiration cools leaf surfaces sometimes 10 to 15 degrees, by evaporative cooling.
In the light of the above statements, choose the most appropriate answer from the options given below :
-
The historic Convention on Biological Diversity, 'The Earth Summit' was held in Rio de Janeiro in the year :
-
Movement and accumulation of ions across a membrane against their concentration gradient can be explained by
-
Axile placentation is observed in
-
Identify the correct statements :
A. Detrivores perform fragmentation.
B. The humus is further degraded by some microbes during mineralization.
C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching.
D. The detritus food chain begins with living organisms.
E. Earthworms break down detritus into smaller particles by a process called catabolism.
Choose the correct answer from the options given below :
-
Among eukaryotes, replication of DNA takes place in -
-
Given below are two statements :
Statement I : Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body.
Statement II : Exarch condition is the most common feature of the root system.
In the light of the above statements, choose the correct answer from the options given below :
-
The phenomenon of pleiotropism refers to
-
Identify the pair of heterosporous pteridophytes among the following :
-
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : Late wood has fewer xylary elements with narrow vessels.
Reason R : Cambium is less active in winters.
In the light of the above statements, choose the correct answer from the options given below :
-
Identify the correct statements :
A. Lenticels are the lens-shaped openings permitting the exchange of gases.
B. Bark formed early in the season is called hard bark.
C. Bark is a technical term that refers to all tissues exterior to vascular cambium.
D. Bark refers to periderm and secondary phloem.
E. Phellogen is single-layered in thickness.
Choose the correct answer from the options given below :
-
Match List I with List II :
List I | List II
A. M Phase | I. Proteins are synthesized
B. G\(_2\) Phase | II. Inactive phase
C. Quiescent stage | III. Interval between mitosis and initiation of DNA replication
D. G\(_1\) Phase | IV. Equational division
Choose the correct answer from the options given below :
-
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : In gymnosperms the pollen grains are released from the microsporangium and carried by air currents.
Reason R : Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed.
In the light of the above statements, choose the correct answer from the options given below :
-
Match List I with List II :
List I | List II
A. Iron | I. Synthesis of auxin
B. Zinc | II. Component of nitrate reductase
C. Boron | III. Activator of catalase
D. Molybdenum | IV. Cell elongation and differentiation
Choose the correct answer from the options given below :
-
Which of the following combinations is required for chemiosmosis?
-
Which one of the following statements is NOT correct?
-
Which of the following statements are correct about Klinefelter's Syndrome?
A. This disorder was first described by Langdon Down (1866).
B. Such an individual has overall masculine development. However, the feminine development is also expressed.
C. The affected individual is short statured.
D. Physical, psychomotor and mental development is retarded.
E. Such individuals are sterile.
Choose the correct answer from the options given below :
-
Match List I with List II :
List I (Interaction) | List II (Species A and B)
A. Mutualism | I. +(A), O(B)
B. Commensalism | II. -(A), O(B)
C. Amensalism | III. +(A), -(B)
D. Parasitism | IV. +(A), +(B)
Choose the correct answer from the options given below :
-
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : A flower is defined as modified shoot wherein the shoot apical meristem changes to floral meristem.
Reason R : Internode of the shoot gets condensed to produce different floral appendages laterally at successive nodes instead of leaves.
In the light of the above statements, choose the correct answer from the options given below :
-
How many different proteins does the ribosome consist of?
-
Match List I with List II :
List I | List II
A. Cohesion | I. More attraction in liquid phase
B. Adhesion | II. Mutual attraction among water molecules
C. Surface tension | III. Water loss in liquid phase
D. Guttation | IV. Attraction towards polar surfaces
Choose the correct answer from the options given below :
-
Match List I with List II :
List I | List II
A. Oxidative decarboxylation | I. Citrate synthase
B. Glycolysis | II. Pyruvate dehydrogenase
C. Oxidative phosphorylation | III. Electron transport system
D. Tricarboxylic acid cycle | IV. EMP pathway
Choose the correct answer from the options given below :
-
Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of
-
Given below are two statements :
Statement I : Gause's 'Competitive Exclusion Principle' states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually.
Statement II : In general, carnivores are more adversely affected by competition than herbivores.
In the light of the above statements, choose the correct answer from the options given below :
-
Match List I with List II.
List I: A. Gene 'a'; B. Gene 'y'; C. Gene 'i'; D. Gene 'z'
List II: I. β-galactosidase; II. Transacetylase; III. Permease; IV. Repressor protein
Choose the correct answer from the options given below:
-
Which of the following are NOT considered as the part of endomembrane system?
A. Mitochondria
B. Endoplasmic Reticulum
C. Chloroplasts
D. Golgi complex
E. Peroxisomes
Choose the most appropriate answer from the options given below:
-
Match List I with List II.
List I (Interacting species): A. A Leopard and a Lion in a forest/grassland; B. A Cuckoo laying egg in a Crow's nest; C. Fungi and root of a higher plant in Mycorrtizae; D. A cattle egret and a Cattle in a field
List II (Name of Interaction): I. Competition; II. Brood parasitism; III. Mutualism; IV. Commensalism
Choose the correct answer from the options given below:
-
Given below are two statements:
Statement I: Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat.
Statement II: When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor.
In the light of the above statements, choose the correct answer from the options given below:
-
Given below are two statements:
Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal)
Statement II: Adult human haemoglobin, consists of 4 subunits (two subunits of \(\alpha\) type and two subunits of \(\beta\) type.)
In the light of the above statements, choose the correct answer from the options given below:
-
Given below are two statements:
Statement I: Electrostatic precipitator is most widely used in thermal power plant.
Statement II: Electrostatic precipitator in thermal power plant removes ionising radiations
In the light of the above statements, choose the most appropriate answer from the options given below:
-
Which of the following functions is carried out by cytoskeleton in a cell?
-
Broad palm with single palm crease is visible in a person suffering from-
-
Given below are two statements:
Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.
Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.
In the light of the above statements, choose the correct answer from the options given below:
-
Which of the following statements is correct?
-
Which one of the following symbols represents mating between relatives in human pedigree analysis?
-
Match List I with List II.
List I: A. Logistic growth; B. Exponential growth; C. Expanding age pyramid; D. Stable age pyramid
List II: I. Unlimited resource availability condition; II. Limited resource availability condition; III. The percent individuals of pre-reproductive age is largest followed by reproductive and post reproductive age groups; IV. The percent individuals of pre-reproductives and reproductive age group are same
Choose the correct answer from the options given below:
-
Given below are two statements:
Statement I: During G\(_0\) phase of cell cycle, the cell is metabolically inactive.
Statement II: The centrosome undergoes duplication during S phase of interphase.
In the light of the above statements, choose the most appropriate answer from the options given below:
-
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows
5' AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3'?
-
Select the correct statements.
A. Tetrad formation is seen during Leptotene.
B. During Anaphase, the centromeres split and chromatids separate.
C. Terminalization takes place during Pachytene.
D. Nucleolus, Golgi complex and ER are reformed during Telophase.
E. Crossing over takes place between sister chromatids of homologous chromosome.
Choose the correct answer from the options given below:
NEET UG 2022 question paper (official, booklet R6)
Full paper →-
Which of the following is not observed during apoplastic pathway ?
-
The device which can remove particulate matter present in the exhaust from a thermal power plant is :
-
Which one of the following never occurs during mitotic cell division ?
-
Hydrocolloid carrageen is obtained from :
-
Read the following statements about the vascular bundles :
(a) In roots, xylem and phloem in a vascular bundle are arranged in an alternate manner along the different radii.
(b) Conjoint closed vascular bundles do not possess cambium
(c) In open vascular bundles, cambium is present in between xylem and phloem
(d) The vascular bundles of dicotyledonous stem possess endarch protoxylem
(e) In monocotyledonous root, usually there are more than six xylem bundles present
Choose the correct answer from the options given below :
-
DNA polymorphism forms the basis of :
-
The appearance of recombination nodules on homologous chromosomes during meiosis characterizes :
-
The flowers are Zygomorphic in :
(a) Mustard
(b) Gulmohar
(c) Cassia
(d) Datura
(e) Chilly
Choose the correct answer from the options given below :
-
Production of Cucumber has increased manifold in recent years. Application of which of the following phytohormones has resulted in this increased yield as the hormone is known to produce female flowers in the plants :
-
In old trees the greater part of seco[...] dark brown and resistant to insect attack due [...]
(a) secretion of secondary metabolites and their deposition in the lumen of vessels.
(b) deposition of organic compounds like tannins and resins in the central layers of stem.
(c) deposition of suberin and aromatic substances in the outer layer of stem.
(d) deposition of tannins, gum, resin and aromatic substances in the peripheral layers of stem.
(e) presence of parenchyma cells, functionally active xylem elements and essential oils.
Choose the correct answer from the options given below :
-
Which of the following is incorrectly matched ?
-
Which one of the following plants does not show plasticity ?
-
Read the following statements and choose the set of correct statements :
(a) Euchromatin is loosely packed chromatin
(b) Heterochromatin is transcriptionally active
(c) Histone octomer is wrapped by negatively charged DNA in nucleosome
(d) Histones are rich in lysine and arginine
(e) A typical nucleosome contains 400 bp of DNA helix
Choose the correct answer from the options given below :
-
Which one of the following produces nitrogen fixing nodules on the roots of Alnus ?
-
Identify the incorrect statement related to Pollination :
-
Which of the following is not a method of ex situ conservation ?
-
Which one of the following is not true regarding the release of energy during ATP synthesis through chemiosmosis ? It involves :
-
Which one of the following statements cannot be connected to Predation ?
-
Given below are two statements :
Statement I :
Cleistogamous flowers are invariably autogamous
Statement II :
Cleistogamy is disadvantageous as there is no chance for cross pollination
In the light of the above statements, choose the correct answer from the options given below :
-
Given below are two statements :
Statement I :
The primary CO\(_2\) acceptor in C\(_4\) plants is phosphoenolpyruvate and is found in the mesophyll cells.
Statement II :
Mesophyll cells of C\(_4\) plants lack RuBisCo enzyme.
In the light of the above statements, choose the correct answer from the options given below :
-
Identify the correct set of statements :
(a) The leaflets are modified into pointed hard thorns in Citrus and Bougainvillea
(b) Axillary buds form slender and spirally coiled tendrils in cucumber and pumpkin
(c) Stem is flattened and fleshy in Opuntia and modified to perform the function of leaves
(d) Rhizophora shows vertically upward growing roots that help to get oxygen for respiration
(e) Subaerially growing stems in grasses and strawberry help in vegetative propagation
Choose the correct answer from the options given below :
-
The gaseous plant growth regulator is used in plants to :
-
Which one of the following plants shows vexillary aestivation and diadelphous stamens ?
-
XO type of sex determination can be found in :
-
What amount of energy is released from glucose during lactic acid fermentation ?
-
Given below are two statements :
Statement I :
Decomposition is a process in which the detritus is degraded into simpler substances by microbes.
Statement II :
Decomposition is faster if the detritus is rich in lignin and chitin
In the light of the above statements, choose the correct answer from the options given below :
-
What is the net gain of ATP when each molecule of glucose is converted to two molecules of pyruvic acid ?
-
Match List - I with List - II.
List - I: (a) Manganese (b) Magnesium (c) Boron (d) Iron
List - II: (i) Activates the enzyme catalase (ii) Required for pollen germination (iii) Activates enzymes of respiration (iv) Functions in splitting of water during photosynthesis
Choose the correct answer from the options given below :
-
Habitat loss and fragmentation, over exploitation, alien species invasion and co-extinction are causes for :
-
The process of translation of mRNA to proteins begins as soon as :
-
"Girdling Experiment" was performed by Plant Physiologists to identify the plant tissue through which :
-
Exoskeleton of arthropods is composed of :
-
Given below are two statements :
Statement I :
Mendel studied seven pairs of contrasting traits in pea plants and proposed the Laws of Inheritance
Statement II :
Seven characters examined by Mendel in his experiment on pea plants were seed shape and colour, flower colour, pod shape and colour, flower position and stem height
In the light of the above statements, choose the correct answer from the options given below :
-
Which part of the fruit, labelled in the given figure makes it a false fruit ?
-
Addition of more solutes in a given solution will :
-
The anatomy of springwood shows some peculiar features. Identify the correct set of statements about springwood.
(a) It is also called as the earlywood
(b) In spring season cambium produces xylem elements with narrow vessels
(c) It is lighter in colour
(d) The springwood along with autumnwood shows alternate concentric rings forming annual rings
(e) It has lower density
Choose the correct answer from the options given below :
-
Which one of the following will accelerate phosphorus cycle ?
-
The entire fleet of buses in Delhi were converted to CNG from diesel. In reference to this, which one of the following statements is false ?
-
What is the role of large bundle shealth cells found around the vascular bundles in C\(_4\) plants ?
-
Which of the following occurs due to the presence of autosome linked dominant trait ?
-
Read the following statements on lipids and find out correct set of statements :
(a) Lecithin found in the plasma membrane is a glycolipid
(b) Saturated fatty acids possess one or more c=c bonds
(c) Gingely oil has lower melting point, hence remains as oil in winter
(d) Lipids are generally insoluble in water but soluble in some organic solvents
(e) When fatty acid is esterified with glycerol, monoglycerides are formed
Choose the correct answer from the options given below :
-
If a geneticist uses the blind approach for sequencing the whole genome of an organism, followed by assignment of function to different segments, the methodology adopted by him is called as :
-
Match the plant with the kind of life cycle it exhibits :
List - I: (a) Spirogyra (b) Fern (c) Funaria (d) Cycas
List - II: (i) Dominant diploid sporophyte vascular plant, with highly reduced male or female gametophyte (ii) Dominant haploid free-living gametophyte (iii) Dominant diploid sporophyte alternating with reduced gametophyte called prothallus (iv) Dominant haploid leafy gametophyte alternating with partially dependent multicellular sporophyte
-
While explaining interspecific interaction of population, (+) sign is assigned for beneficial interaction, (-) sign is assigned for detrimental interaction and (0) for neutral interaction. Which of the following interactions can be assigned (+) for one species and (-) for another species involved in the interaction ?
-
Match List - I with List - II.
List - I: (a) Metacentric chromosome (b) Acrocentric chromosome (c) Sub-metacentric chromosome (d) Telocentric chromosome
List - II: (i) Centromere situated close to the end forming one extremely short and one very long arms (ii) Centromere at the terminal end (iii) Centromere in the middle forming two equal arms of chromosomes (iv) Centromere slightly away from the middle forming one shorter arm and one longer arm
Choose the correct answer from the options given below :
-
Given below are two statements : one is labelled as Assertion (A) and the other is labelled as Reason (R).
Assertion (A) :
Mendel's law of Independent assortment does not hold good for the genes that are located closely on the same chromosome.
Reason (R) :
Closely located genes assort independently.
In the light of the above statements, choose the correct answer from the options given below :
-
Which of the following statements with respect to Endoplasmic Reticulum is incorrect ?
-
Regarding Meiosis, which of the statements is incorrect ?
-
Identify the asexual reproductive structure associated with Penicillium :
-
A dehydration reaction links two glucose molecules to produce maltose. If the formula for glucose is \(C_6H_{12}O_6\) then what is the formula for maltose ?
-
Breeding crops with higher levels of vitamins and minerals or higher proteins and healthier fats is called :
-
Identify the microorganism which is responsible for the production of an immunosuppressive molecule cyclosporin A :
-
Detritivores breakdown detritus into smaller particles. This process is called :
-
If '8' Drosophila in a laboratory population of '80' died during a week, the death rate in the population is ______ individuals per Drosophila per week.
-
In-situ conservation refers to :
-
Given below are two statements :
Statement I :
Mycoplasma can pass through less than 1 micron filter size.
Statement II :
Mycoplasma are bacteria with cell wall
In the light of the above statements, choose the most appropriate answer from the options given below :
-
In the taxonomic categories which hierarchial arrangement in ascending order is correct in case of animals ?
-
In an E.coli strain i gene gets mutated and its product can not bind the inducer molecule. If growth medium is provided with lactose, what will be the outcome ?
-
Select the incorrect statement with reference to mitosis :
-
If the length of a DNA molecule is 1.1 metres, what will be the approximate number of base pairs ?
-
The recombination frequency between the genes a & c is 5%, b & c is 15%, b & d is 9%, a & b is 20%, c & d is 24% and a & d is 29%. What will be the sequence of these genes on a linear chromosome ?
-
If a colour blind female marries a man whose mother was also colour blind, what are the chances of her progeny having colour blindness ?
-
Ten E.coli cells with \(^{15}N\) - dsDNA are incubated in medium containing \(^{14}N\) nucleotide. After 60 minutes, how many E.coli cells will have DNA totally free from \(^{15}N\) ?
-
Given below are two statements :
Statement I :
In a scrubber the exhaust from the thermal plant is passed through the electric wires to charge the dust particles.
Statement II :
Particulate matter (PM 2.5) can not be removed by scrubber but can be removed by an electrostatic precipitator.
In the light of the above statements, choose the most appropriate answer from the options given below :
-
Match List - I with List - II.
List - I (Biological Molecules): (a) Glycogen (b) Globulin (c) Steroids (d) Thrombin
List - II (Biological functions): (i) Hormone (ii) Biocatalyst (iii) Antibody (iv) Storage product
Choose the correct answer from the options given below :
-
Which of the following is a correct statement ?
NEET UG 2021 question paper (official, booklet M4)
Full paper →-
In the equation GPP\(-\)R=NPP
R represents :
-
Inspite of interspecific competition in nature, which mechanism the competing species might have evolved for their survival ?
-
Amensalism can be represented as :
-
Match List - I with List - II.
List - I | List - II
(a) Cells with active cell division capacity | (i) Vascular tissues
(b) Tissue having all cells similar in structure and function | (ii) Meristematic tissue
(c) Tissue having different types of cells | (iii) Sclereids
(d) Dead cells with highly thickened walls and narrow lumen | (iv) Simple tissue
Select the correct answer from the options given below.
-
The production of gametes by the parents, formation of zygotes, the F1 and F2 plants, can be understood from a diagram called :
-
DNA strands on a gel stained with ethidium bromide when viewed under UV radiation, appear as :
-
Gemmae are present in :
-
Plants follow different pathways in response to environment or phases of life to form different kinds of structures. This ability is called :
-
Which of the following is an incorrect statement ?
-
A typical angiosperm embryo sac at maturity is :
-
The plant hormone used to destroy weeds in a field is :
-
Which of the following algae produce Carrageen ?
-
Mutations in plant cells can be induced by :
-
Match List - I with List - II.
List - I | List - II
(a) Protoplast fusion | (i) Totipotency
(b) Plant tissue culture | (ii) Pomato
(c) Meristem culture | (iii) Somaclones
(d) Micropropagation | (iv) Virus free plants
Choose the correct answer from the options given below.
-
Which of the following stages of meiosis involves division of centromere ?
-
Match List - I with List - II.
List - I | List - II
(a) Lenticels | (i) Phellogen
(b) Cork cambium | (ii) Suberin deposition
(c) Secondary cortex | (iii) Exchange of gases
(d) Cork | (iv) Phelloderm
Choose the correct answer from the options given below.
-
The site of perception of light in plants during photoperiodism is :
-
Which of the following plants is monoecious ?
-
When the centromere is situated in the middle of two equal arms of chromosomes, the chromosome is referred as :
-
Genera like Selaginella and Salvinia produce two kinds of spores. Such plants are known as :
-
Complete the flow chart on central dogma.
(a) DNA (with circular arrow) --(b)--> mRNA --(c)--> (d)
-
Which of the following statements is not correct ?
-
Which of the following algae contains mannitol as reserve food material ?
-
Match List - I with List - II.
List - I | List - II
(a) Cohesion | (i) More attraction in liquid phase
(b) Adhesion | (ii) Mutual attraction among water molecules
(c) Surface tension | (iii) Water loss in liquid phase
(d) Guttation | (iv) Attraction towards polar surfaces
Choose the correct answer from the options given below.
-
Diadelphous stamens are found in :
-
Which of the following are not secondary metabolites in plants ?
-
Match List - I with List - II.
List - I | List - II
(a) Cristae | (i) Primary constriction in chromosome
(b) Thylakoids | (ii) Disc-shaped sacs in Golgi apparatus
(c) Centromere | (iii) Infoldings in mitochondria
(d) Cisternae | (iv) Flattened membranous sacs in stroma of plastids
Choose the correct answer from the options given below.
-
The term used for transfer of pollen grains from anthers of one plant to stigma of a different plant which, during pollination, brings genetically different types of pollen grains to stigma, is :
-
The amount of nutrients, such as carbon, nitrogen, phosphorus and calcium present in the soil at any given time, is referred as :
-
The first stable product of CO\(_2\) fixation in sorghum is :
-
Which of the following statements is incorrect ?
-
Identify the correct statement.
-
Match Column - I with Column - II.
Column - I (floral formulae) | Column - II
(a) %♀♂ K(5) C1+2+(2) A(9)+1 G̱(1) | (i) Brassicaceae
(b) ⊕♀♂ K(5) C(5) A5 G̱(2) | (ii) Liliaceae
(c) ⊕♀♂ P(3+3) A3+3 G̱(3) | (iii) Fabaceae
(d) ⊕♀♂ K2+2 C4 A2−4 G̱(2) | (iv) Solanaceae
Select the correct answer from the options given below.
-
Select the correct pair.
-
In the exponential growth equation \(N_t=N_0e^{rt}\), e represents :
-
What is the role of RNA polymerase III in the process of transcription in eukaryotes ?
-
Match List - I with List - II.
List - I | List - II
(a) S phase | (i) Proteins are synthesized
(b) G2 phase | (ii) Inactive phase
(c) Quiescent stage | (iii) Interval between mitosis and initiation of DNA replication
(d) G1 phase | (iv) DNA replication
Choose the correct answer from the options given below.
-
Which of the following statements is correct ?
-
Which of the following statements is incorrect ?
-
In some members of which of the following pairs of families, pollen grains retain their viability for months after release ?
-
Match Column - I with Column - II.
Column - I | Column - II
(a) Nitrococcus | (i) Denitrification
(b) Rhizobium | (ii) Conversion of ammonia to nitrite
(c) Thiobacillus | (iii) Conversion of nitrite to nitrate
(d) Nitrobacter | (iv) Conversion of atmospheric nitrogen to ammonia
Choose the correct answer from options given below.
-
DNA fingerprinting involves identifying differences in some specific regions in DNA sequence, called as :
-
Match List - I with List - II.
List - I | List - II
(a) Protein | (i) C=C double bonds
(b) Unsaturated fatty acid | (ii) Phosphodiester bonds
(c) Nucleic acid | (iii) Glycosidic bonds
(d) Polysaccharide | (iv) Peptide bonds
Choose the correct answer from the options given below.
-
The organelles that are included in the endomembrane system are :
-
Which of the following RNAs is not required for the synthesis of protein ?
-
Which of the following is not an objective of Biofortification in crops ?
-
The fruit fly has 8 chromosomes (2n) in each cell. During interphase of Mitosis if the number of chromosomes at G\(_1\) phase is 8, what would be the number of chromosomes after S phase ?
-
Which is the "Only enzyme" that has "Capability" to catalyse Initiation, Elongation and Termination in the process of transcription in prokaryotes ?
-
In a cross between a male and female, both heterozygous for sickle cell anaemia gene, what percentage of the progeny will be diseased ?
-
Which stage of meiotic prophase shows terminalisation of chiasmata as its distinctive feature ?
-
Dobson units are used to measure thickness of :
-
Identify the incorrect pair.
-
Persons with ‘AB’ blood group are called as "Universal recipients". This is due to :
-
The centriole undergoes duplication during :
-
Match List - I with List - II.
List - I / List - II
(a) Aspergillus niger (i) Acetic Acid
(b) Acetobacter aceti (ii) Lactic Acid
(c) Clostridium butylicum (iii) Citric Acid
(d) Lactobacillus (iv) Butyric Acid
Choose the correct answer from the options given below.
-
If Adenine makes 30% of the DNA molecule, what will be the percentage of Thymine, Guanine and Cytosine in it ?
-
Which one of the following statements about Histones is wrong ?
-
Match List - I with List - II.
List - I / List - II
(a) Allen's Rule (i) Kangaroo rat
(b) Physiological adaptation (ii) Desert lizard
(c) Behavioural adaptation (iii) Marine fish at depth
(d) Biochemical adaptation (iv) Polar seal
Choose the correct answer from the options given below.
-
Statement I :
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II :
‘AAA’ and ‘AAG’ both codons code for the amino acid lysine.
In the light of the above statements, choose the correct answer from the options given below.
-
Following are the statements with reference to ‘lipids’.
(a) Lipids having only single bonds are called unsaturated fatty acids.
(b) Lecithin is a phospholipid.
(c) Trihydroxy propane is glycerol.
(d) Palmitic acid has 20 carbon atoms including carboxyl carbon.
(e) Arachidonic acid has 16 carbon atoms.
Choose the correct answer from the options given below.
NEET UG 2020 question paper (official, booklet E1)
Full paper →-
Which of the following is not an attribute of a population ?