Botany
- Identify the set of correct statements:A. The flowers of Vallisneria are colourful and produce nectar.B. The flowers of waterlily are not pollinated by water.C. In most of water-pollinated species, the pollen grains are protected from wetting.D. Poll… Answer: 1. B, C, D and E only Key idea: only some aquatic plants are water pollinated, and these flowers are inconspicuous. A is false: Vall... 1
- Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b) Answer: 1. (a) Perigynous; (b) Perigynous Key idea: the position of the thalamus and the other whorls decides hypogynous, perigynous or epig... 1
- Identify the part of the seed from the given figure which is destined to form root when the seed germinates. Answer: 4. C Key idea: in a monocot seed (grain), the radicle lies inside a protective sheath called the coleorhiza. In the figure, A is the... 1
- Which of the following is an example of actinomorphic flower? Answer: 2. Datura Key idea: actinomorphic flowers can be cut into two equal halves in any vertical plane (radial symmetry). Datura is actino... 1
- Bulliform cells are responsible for Answer: 2. Inward curling of leaves in monocots. Key idea: bulliform cells are large colourless cells on the upper epidermis of grass leaves... 1
- In the given figure, which component has thin outer walls and highly thickened inner walls? Answer: 2. C Key idea: in dicot guard cells the wall facing the stomatal pore (inner wall) is thick and the outer wall is thin. In the figur... 1
- Match List I with List IIList I: A. Clostridium butylicum; B. Saccharomyces cerevisiae; C. Trichoderma polysporum; D. Streptococcus sp.List II: I. Ethanol; II. Streptokinase; III. Butyric acid; IV. Cyclosporin-AChoose the correct answer from the opti… Answer: 4. A-III, B-I, C-IV, D-II Key idea: match each microbe with the product it yields. Clostridium butylicum makes butyric acid (A-III).... 1
- Spindle fibers attach to kinetochores of chromosomes during Answer: 3. Metaphase Key idea: chromosomes line up at the equator in metaphase, with spindle fibres attached to their kinetochores. In metap... 1
- Given below are two statements:Statement I : Chromosomes become gradually visible under light microscope during leptotene stage.Statement II : The begining of diplotene stage is recognized by dissolution of synaptonemal complex.In the light of the ab… Answer: 2. Both Statement I and Statement II are true Key idea: recall what happens in each substage of prophase I. Statement I: In leptoten... 1
- The cofactor of the enzyme carboxypeptidase is: Answer: 2. Zinc Key idea: carboxypeptidase is a metalloenzyme whose cofactor is a metal ion, zinc. Zinc ( Zn²⁺ ) is held in the active site... 1
- These are regarded as major causes of biodiversity loss:A. Over exploitationB. Co-extinctionC. MutationD. Habitat loss and fragmentationE. MigrationChoose the correct option: Answer: 1. A, B and D only Key idea: the "evil quartet" of biodiversity loss is habitat loss and fragmentation, over-exploitation, alien spe... 1
- The equation of Verhulst-Pearl logistic growth isdN/dt = rN≤ft[K-N/K].From this equation, K indicates: Answer: 4. Carrying capacity Key idea: in the Verhulst-Pearl logistic equation, K is the carrying capacity. In dN/dt=rN[K-N/K] , N is popula... 1
- In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it? Answer: 3. bb Key idea: an unknown dominant phenotype is tested by a test cross with the homozygous recessive parent. Cross the black plant... 1
- How many molecules of ATP and NADPH are required for every molecule of CO_2 fixed in the Calvin cycle? Answer: 1. 3 molecules of ATP and 2 molecules of NADPH Key idea: fixing one CO₂ in the Calvin cycle costs 3 ATP and 2 NADPH. One CO₂ joins R... 1
- Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin Answer: 4. does not affect mature monocotyledonous plants. Key idea: synthetic auxins like 2,4-D kill dicot weeds but not monocot crops or g... 1
- Given below are two statements:Statement I : Parenchyma is living but collenchyma is dead tissue.Statement II : Gymnosperms lack xylem vessels but presence of xylem vessels is the characteristic of angiosperms.In the light of the above statements, ch… Answer: 1. Statement I is false but Statement II is true Key idea: check each statement against tissue properties. Statement I: Parenchyma i... 1
- Given below are two statements:Statement I: During G_0 phase of cell cycle, the cell is metabolically inactive.Statement II: The centrosome undergoes duplication during S phase of interphase.In the light of the above statements, choose the most appro… Answer: 1. Statement I is incorrect but Statement II is correct. Key idea: G₀ is a quiescent stage, not a dead stage. Statement I is incorre... 1
- Select the correct statements.A. Tetrad formation is seen during Leptotene.B. During Anaphase, the centromeres split and chromatids separate.C. Terminalization takes place during Pachytene.D. Nucleolus, Golgi complex and ER are reformed during Teloph… Answer: 3. B and D only Key idea: Check the stages of cell division. A is wrong: tetrads form in pachytene, after synapsis; leptotene is the... 1
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows5' AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3'? Answer: 4. 5' ATCGATCGATCGATCGATCG ATCGATCG 3' Key idea: The coding strand has the same sequence as the mRNA, with T in place of U. The mRNA... 1
- Given below are two statements:Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal)Statement II: Adult human haemoglobin, consists of 4 s… Answer: 1. Statement I is false but Statement II is true. Key idea: Check the orientation of a protein and the structure of haemoglobin. Sta... 1
- Given below are two statements:Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively… Answer: 1. Statement I incorrect but Statement II is true. Key idea: DNA is negatively charged because of its phosphate groups. Statement I... 1
- Which of the following functions is carried out by cytoskeleton in a cell? Answer: 4. Motility Key idea: The cytoskeleton is a network of protein filaments that gives mechanical support, maintains cell shape and hel... 1
- Which of the following statements is correct? Answer: 3. Biomagnification refers to increase in concentration of the toxicant at successive trophic levels. Key idea: Look at each stateme... 1
- Given below are two statements:Statement I: Electrostatic precipitator is most widely used in thermal power plant.Statement II: Electrostatic precipitator in thermal power plant removes ionising radiationsIn the light of the above statements, choose… Answer: 4. Statement I is correct but Statement II is incorrect. Key idea: An electrostatic precipitator removes particulate matter, not rad... 1