NEET UG
- If x=5≤ft(π t+π/3)m represents the motion of a particle executing simple harmonic motion, the amplitude and time period of motion, respectively, are : Answer: 3. 5 m, 2 s Key idea: Compare with the standard SHM form x=Asin(ω t+φ) . Here A=5 m and ω=π rad/s. Time period T=2π/ω=2π/π=2 s. Ampl... 1
- The quantities which have the same dimensions as those of solid angle are : Answer: 2. strain and angle Key idea: Solid angle (like plane angle) is a ratio of two lengths/areas, so it is dimensionless. Strain (change... 1
- The maximum elongation of a steel wire of 1 m length if the elastic limit of steel and its Young's modulus, respectively, are 8×10^8 N m^-2 and 2×10^11 N m^-2, is : Answer: 2. 4 mm Key idea: The largest stress the wire can bear without permanent change is the elastic limit. Use Y=stress/strain . Strain =... 1
- A thin flat circular disc of radius 4.5 cm is placed gently over the surface of water. If surface tension of water is 0.07 Nm^-1, then the excess force required to take it away from the surface is : Answer: 2. 19.8 mN Key idea: The surface-tension force acts along the line of contact between the disc and the water, which is the circumfer... 1
- A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is v in the direction shown, which one of the following options is correct (P and Q are any highest and lowest points on the wheel, respectively)? Answer: 3. Point P moves faster than point Q . Key idea: In pure rolling, each point has speed = (speed of centre) + (rotational speed about... 1
- A thermodynamic system is taken through the cycle abcda. The work done by the gas along the path bc is : Answer: 2. zero Key idea: Work done by a gas is W=∫ P dV , so it is zero when the volume does not change. In the figure, path bc is vertical... 1
- Two bodies A and B of same mass undergo completely inelastic one dimensional collision. The body A moves with velocity v_1 while body B is at rest before collision. The velocity of the system after collision is v_2. The ratio v_1 : v_2 is : Answer: 3. 2:1 Key idea: In a completely inelastic collision the bodies stick together and momentum is conserved. mv₁+0=(m+m)v₂ , so v₂=v₁/2... 1
- At any instant of time t, the displacement of any particle is given by 2t-1 (SI unit) under the influence of force of 5N. The value of instantaneous power is (in SI unit): Answer: 2. 10 Key idea: Instantaneous power P=vec F·vec v . Velocity v=d/dt(2t-1)=2 m/s (constant). Then P=Fv=5×2=10 W. Option 2. 1
- Match List I with List II.List I (Spectral Lines of Hydrogen for transitions from): A. n_2=3 to n_1=2; B. n_2=4 to n_1=2; C. n_2=5 to n_1=2; D. n_2=6 to n_1=2List II (Wavelengths (nm)): I. 410.2; II. 434.1; III. 656.3; IV. 486.1Choose the correct ans… Answer: 3. A-III, B-IV, C-II, D-I Key idea: These are Balmer lines (transitions to n=2 ); a larger jump means more energy and a shorter wave... 1
- A wire of length 'l' and resistance 100 Ω is divided into 10 equal parts. The first 5 parts are connected in series while the next 5 parts are connected in parallel. The two combinations are again connected in series. The resistance of this final com… Answer: 3. 52 Ω Key idea: Each of the 10 equal parts has resistance 100/10=10\ Ω . Five parts in series: 5×10=50\ Ω . Five parts in parallel... 1
- The graph which shows the variation of ≤ft(1/λ^2) and its kinetic energy, E is (where λ is de Broglie wavelength of a free particle) : Answer: 1. graph (1) Key idea: For a free particle E=p²/2m and λ=h/p . So E=h²/2mλ² , which gives frac1λ²=2m/h²E . frac1λ² is directly propo... 1
- Consider the following statements A and B and identify the correct answer :A. For a solar-cell, the I-V characteristics lies in the IV quadrant of the given graph.B. In a reverse biased pn junction diode, the current measured in (μ A), is due to majo… Answer: 2. A is correct but B is incorrect. Key idea: Check each statement separately. A: A solar cell works as a generator, so its I-V curv... 1
- The output (Y) of the given logic gate is similar to the output of an/a : Answer: 1. AND gate Key idea: Find the output of each first-stage gate, then apply the final NOR gate. With the inputs of each gate joined,... 1
- In a vernier calipers, (N+1) divisions of vernier scale coincide with N divisions of main scale. If 1 MSD represents 0.1 mm, the vernier constant (in cm) is : Answer: 3. 1/100(N+1) Key idea: Vernier constant = 1 MSD - 1 VSD. N main scale divisions equal N+1 vernier divisions, so 1 VSD=N/N+1 MSD . V... 1
- A particle moving with uniform speed in a circular path maintains : Answer: 1. varying velocity and varying acceleration. Key idea: Velocity and acceleration are vectors, so a change in direction counts as a... 1
- Match List-I with List-II.List-I (Material): A. Diamagnetic; B. Ferromagnetic; C. Paramagnetic; D. Non-magneticList-II (Susceptibility ()): I. =0; II. 0>≥-1; III. 1; IV. 0<<ε (a small positive number)Choose the correct answer from the options given b… Answer: 2. A-II, B-III, C-IV, D-I Key idea: The sign and size of magnetic susceptibility chi identify the type of material. Diamagnetic: chi... 1
- In a uniform magnetic field of 0.049 T, a magnetic needle performs 20 complete oscillations in 5 seconds as shown. The moment of inertia of the needle is 9.8×10^-6 kg m^2. If the magnitude of magnetic moment of the needle is x×10^-5 Am^2; then the va… Answer: 1. 1280 π² Key idea: A magnetic needle in a field oscillates like a torsional pendulum: T=2π√(I/MB) . Period T=5/20=0.25 s. Squaring... 1
- An unpolarised light beam strikes a glass surface at Brewster's angle. Then Answer: 1. the reflected light will be completely polarised but the refracted light will be partially polarised. Key idea: At Brewster's ang... 1
- A light ray enters through a right angled prism at point P with the angle of incidence 30^° as shown in figure. It travels through the prism parallel to its base BC and emerges along the face AC. The refractive index of the prism is: Answer: 3. sqrt5/2 Key idea: The ray leaves along face AC, so its angle of incidence on AC is the critical angle C , with sin C=frac1μ . Let... 1
- The moment of inertia of a thin rod about an axis passing through its mid point and perpendicular to the rod is 2400 g cm^2. The length of the 400 g rod is nearly : Answer: 2. 8.5 cm Key idea: For a thin rod about its midpoint and perpendicular to its length, I=ML²/12 . L²=12I/M=12×2400/400=72 , so L=√(7... 1
- Given below are two statements:Statement I: During G_0 phase of cell cycle, the cell is metabolically inactive.Statement II: The centrosome undergoes duplication during S phase of interphase.In the light of the above statements, choose the most appro… Answer: 1. Statement I is incorrect but Statement II is correct. Key idea: G₀ is a quiescent stage, not a dead stage. Statement I is incorre... 1
- Select the correct statements.A. Tetrad formation is seen during Leptotene.B. During Anaphase, the centromeres split and chromatids separate.C. Terminalization takes place during Pachytene.D. Nucleolus, Golgi complex and ER are reformed during Teloph… Answer: 3. B and D only Key idea: Check the stages of cell division. A is wrong: tetrads form in pachytene, after synapsis; leptotene is the... 1
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows5' AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3'? Answer: 4. 5' ATCGATCGATCGATCGATCG ATCGATCG 3' Key idea: The coding strand has the same sequence as the mRNA, with T in place of U. The mRNA... 1
- Select the correct statements with reference to chordates.A. Presence of a mid-dorsal, solid and double nerve cord.B. Presence of closed circulatory system.C. Presence of paired pharyngeal gillslits.D. Presence of dorsal heartE. Triploblastic pseudoc… Answer: 3. B and C only Key idea: Recall the basic features of chordates. A is wrong: the nerve cord is dorsal, hollow and single. B is corr... 1